Busch Lab

ZMP

atad5a

Ensembl ID:
ENSDARG00000070568
ZFIN ID:
ZDB-GENE-070912-20
Description:
Si:ch211-11k18.10 protein [Source:UniProtKB/TrEMBL;Acc:A9JSS3]
Human Orthologue:
ATAD5
Human Description:
ATPase family, AAA domain containing 5 [Source:HGNC Symbol;Acc:25752]
Mouse Orthologue:
Atad5
Mouse Description:
ATPase family, AAA domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442925]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa20016 Essential Splice Site Available for shipment Available now
sa6894 Nonsense Mutation detected in F1 DNA Not yet available
sa33178 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15159 Nonsense Available for shipment Available now
sa14858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20016
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Essential Splice Site 17 1778 None 23
ENSDART00000103734 Essential Splice Site None 766 None 9
ENSDART00000103737 Essential Splice Site 17 1778 None 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26790151)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26114085
GRCz11 3 26244956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGGGGTTGTTGCATTGCCAGCTGTCATGGAGGATTTCGAGGGTCAGG[T/G]ATGTGTCTTATTAATAATGTGTAACTGTTAATCTGTTATGGCTGTGTTTT
Long Flanking Sequence:
AAAGTAATTTTCCACGCGGAGCGGGTTTGTGGGTTGGTTCTTACAACGCGTTATGCTTGTTTTCGCCGGGAAGTATATCGTTGTTTGGTAAATGTGTCGATAGATAGGCTTTGTGTTTACTCGGAGTCGTTGCTGGATTCATATTTATGCACTCTTCACTGTAATTCATGGATTATGTATCAGCAGATCCCCGAGGGAAATAAAACAACAGGTGAGTGTCTGCAATTTAAATACATTTCTTCAAACACACTTTGACTAACTTACACTTTTACCAGCGTTATGCTAACATATTAAGCAACATTCACCCAAACTGTTACAGTAGCTGTTTATGAATTATAACATTTATAATAACATTTTAAATCTTTCATGACACTTTTGTTTGGCGTGCTCGCGTTTAACCTCTTTTAAAATCCTTCTTAAATGCAGATCTTTAGTTTTAGGGTGAAAGATGGCTGGGGTTGTTGCATTGCCAGCTGTCATGGAGGATTTCGAGGGTCAGG[T/G]ATGTGTCTTATTAATAATGTGTAACTGTTAATCTGTTATGGCTGTGTTTTAGTTATATAATCAGAAAAGTGTAATATTTATATTAAATTAAAATTGTTGCTTTTCCAGCCGTGCAAAAAAATGAGAAAGGATGGCGATGCACCATCTGTCAGAACTATCACTAACTACTTTGCACCCAAGATAGTGGAGAAACCGTTCTCACCGCCTCGATCCAACAACATCATGGACTTCTTCAAGAAGACCTCGCCTGCACCAGAAATAAAAAACTGCTCTCTGAAAGCTAAAGAAAACTCGCCGCATTCTTCAGAGCAAGTAAGTCAAGAAGTCTCAGGGAAACCTGTTCGAGGACGAGGGCAGAAGCGCACCAGGAAGACTAAAGACAAGAAGAAATCTAAAGAGGAGGATGCACAGGTGGTCACAGATGATGTTGTGCTTATTGAGAGTCCCGGTGATTCAAAGGAAAGTGAAACTGCTGGACTTCCAGATAGAACTTGTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6894
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Nonsense 840 1778 10 23
ENSDART00000103734 None None 766 None 9
ENSDART00000103737 Nonsense 840 1778 9 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26778398)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26125838
GRCz11 3 26256709
KASP Assay ID:
554-5009.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTCATTTAGGTTTCTTGTCAGAAGACCGAGTTTTCTGAGCCAATYAGA[C/T]AGTGTCTTTTGGAGAAGATGAGAATCTCCAATCCATCCTTCCCTCATCAG
Long Flanking Sequence:
TTAGAGCTTCTCTTTTGTTTTTTCGCACTTCACTTTTGGGTTTGTTTCTGAAAGGATCAAATATCAGAAGCACTTCATCAAATCACACACACATTATTTTCATCAGCTCAAGAAGTTTGTTATTTCATATATAGATGCGCACGCGAGCTCTCTGGAGAAAGTGAAACCACTCTCCCTTTTGGACGACCTCGTAAACAACAACAGGACACAGGGCAGATTCTGTTTTTTTTGGCTTTGTGGTTGTTCATCAATACGACAGCAAGGTTTGTTTGAGCTTGGGTTGATGAATCTACCAAACCGTACAGCACCGTACCACTCAATGGAAATGCGCCATAAATGTATTTTTTTTATGTGTTCTAAAAGTAATTATATTATTATGATCTTTTCACAGTTGTACAATTGAATAAATCTACTGAATGTGAGTATATGATATATGTTTAACATTTCATCTTGTCATTTAGGTTTCTTGTCAGAAGACCGAGTTTTCTGAGCCAATCAGA[C/T]AGTGTCTTTTGGAGAAGATGAGAATCTCCAATCCATCCTTCCCTCATCAGCGATTCTTTACTCGGTTCATTAAGAGACGTGAAGACTACATCCTCCAGGCTTCTGCAGCAGGTGACACAATAATATTTTATTAGCTTAACTTTGCTTTTATTTTAAGATATGTAACTATGAGTGACTTTCATATGGTTTTGCTCTGTGATTGTTTATAGATCTTGAAGATGAGTCTAAGGAGTCCTGTCATGCTGGATCATCCGATGCTGTCGGGAGAAAACGGAAACGTGTGGATGAAGGAGAGGCAACCGGCAAAATAGGCAAAAAAACTAAATCCAGTCATACAGATGATGATGTCATAGTGATAGAAGTAAGTCCACCATCAAGAGGTGAAGCAGCACAGCCATCTGGGAGAGGTCGAAGAGGTCGATCACTGAGACAAAAGCAGAAAGAAGAGTCCAAACCAGAAGACCAGACCTCACCTGTGAACGATGATGTCATGATTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33178
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Essential Splice Site 877 1778 10 23
ENSDART00000103734 None None 766 None 9
ENSDART00000103737 Essential Splice Site 877 1778 9 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26778285)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26125951
GRCz11 3 26256822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTTCATTAAGAGACGTGAAGACTACATCCTCCAGGCTTCTGCAGCAGG[T/G]GACACAATAATATTTTATTAGCTTAACTTTGCTTTTATTTTAAGATATGT
Long Flanking Sequence:
AGTTTGTTATTTCATATATAGATGCGCACGCGAGCTCTCTGGAGAAAGTGAAACCACTCTCCCTTTTGGACGACCTCGTAAACAACAACAGGACACAGGGCAGATTCTGTTTTTTTTGGCTTTGTGGTTGTTCATCAATACGACAGCAAGGTTTGTTTGAGCTTGGGTTGATGAATCTACCAAACCGTACAGCACCGTACCACTCAATGGAAATGCGCCATAAATGTATTTTTTTTATGTGTTCTAAAAGTAATTATATTATTATGATCTTTTCACAGTTGTACAATTGAATAAATCTACTGAATGTGAGTATATGATATATGTTTAACATTTCATCTTGTCATTTAGGTTTCTTGTCAGAAGACCGAGTTTTCTGAGCCAATCAGACAGTGTCTTTTGGAGAAGATGAGAATCTCCAATCCATCCTTCCCTCATCAGCGATTCTTTACTCGGTTCATTAAGAGACGTGAAGACTACATCCTCCAGGCTTCTGCAGCAGG[T/G]GACACAATAATATTTTATTAGCTTAACTTTGCTTTTATTTTAAGATATGTAACTATGAGTGACTTTCATATGGTTTTGCTCTGTGATTGTTTATAGATCTTGAAGATGAGTCTAAGGAGTCCTGTCATGCTGGATCATCCGATGCTGTCGGGAGAAAACGGAAACGTGTGGATGAAGGAGAGGCAACCGGCAAAATAGGCAAAAAAACTAAATCCAGTCATACAGATGATGATGTCATAGTGATAGAAGTAAGTCCACCATCAAGAGGTGAAGCAGCACAGCCATCTGGGAGAGGTCGAAGAGGTCGATCACTGAGACAAAAGCAGAAAGAAGAGTCCAAACCAGAAGACCAGACCTCACCTGTGAACGATGATGTCATGATTGTGGAACCAGCTGTCTCCAGAAATACAAGCACAGAAGGTGAGCAAAGAATTAACCTAAATTTAATAAAAAATAATCAAAAATGAAGAAAAACTTTAAGATTTTGATTTTGGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1094
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Essential Splice Site 1365 1778 19 23
ENSDART00000103734 None None 766 None 9
ENSDART00000103737 Essential Splice Site 1365 1778 18 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26774243)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26129993
GRCz11 3 26260864
KASP Assay ID:
554-0996.1 (used for ordering genotyping assays)
KASP Sequence:
GCCTGCAGTGGTGRAGTACAGCAGATACAGAGGCCTCTRCCCTCATCAGG[C/A]AAGGATGTATTTAGTTTRATTGWGAAAACATGCTTCAGAAACTTTTTGGC
Long Flanking Sequence:
GTTTTTGATGATGACTTGGGATTCCTGGCTGCAATCAAAACCTTCATGACCACCACTAAGAGACCAGTTATTCTGACAACGAGTGGTGAGTCAAGCTGACTGTGAAAATAAATGTATAACGTGTGGTTTATGAATTAGCCATCATGGGATTTTGTTTTGTGCAGATTCAACTTTCGGTGCCATGTTTGATGGGCAATTCGAGGAGATCCATTTCAAATCTCCTTCAGTGGTAATTAAACAGCAATTCTGTTCTTTTCATAACTATTTTTCTTTGTGATCTGTCTGGTTTTGTAATATTTACTGCTTTGGCTTTTCCAGGCGGATGTTTCCAGTTACGTCCGGCTGTTGTGTCTGGCAGAAAACCTGAGAACTGATAGTAAGGATGTGTCCTGTTTGCTGGAGTGGAACGGCTGTGATATTCGGCAGAGTCTTCTGCAGCTGCAGTTTTGGGCCTGCAGTGGTGGAGTACAGCAGATACAGAGGCCTCTGCCCTCATCAGG[C/A]AAGGATGTATTTAGTTTAATTGAGAAAACATGCTTCAGAAACTTTTTGGCTGTGTATGATAATATGACACTCATCTGTTTTCGCACTATAGAAAGCAAAGGGAAGCCCAAGAGTGGCACTGATCTTCAGCCTGTGAAAGCTGAGGATGTAAAGGAGGAAAATCTGCCACATTGCCACACTGCGTTTACAGAGAGCTTGCTGGGGGTCTGCAATATGCAAACAGAAAATATTGCAGATTTACTGCTTAAGGTGAGTTTTTTTTTCTCTTCCTAAATATATGTATGCACAGATGAAGTGCAGACATCCAAAAATTAATTAATTATATATATAAAAAAGTTTGCGCTAATGCATACTTTATTTTCAGATCATTAATTTGAATATTAAAATAGATTTGAAAATGAATATTTAACATTATTTTTATGAACATATTTTTTAAATCAATAACCTTTAAGGCTTCAAGTAGAATAATTAAATTATAATTTAAAAAATTTTATATACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15159
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Nonsense 1605 1778 21 23
ENSDART00000103734 Nonsense 593 766 7 9
ENSDART00000103737 Nonsense 1605 1778 20 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26772269)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26131967
GRCz11 3 26262838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTKGACTCCTCACTASACTATCAAGCCTCGCAGTCRGARGGGTTTTGC[C/T]GACCCCAGGATTCTGGCTGGACYRGTGCAGAGATCAAGAGCGGGATGACT
Long Flanking Sequence:
GAGGAGTGAATCTTCTCCATTCGAATATGGAGAGTCTGCTTCCACTGCCAACTCGTCTTTTACCCCAGTCCACATTTAAACCACAAGCAGCACCAGCTCCACAGTCCCAGCCTGAGCAACTACCTCAAACTGTGAGATTAGAAAGTTTGGACGAGCCCTCTGATGACGGCAGTCCTCTCAAAGTGTCCGCGAGAATGAAGGGGCGTAAGAAGATGAGCATTAACCACAAAGATGTTTTCCAGTCTGATTCAGAGTCTGAGGAAGACTTCCTCCCACTGCCAAAAAACAGCAGAGATCCTGCTCAAAGCACTAATGTAGAAACAGCCGACGTGCCTGAAGCTGCCCCCAAAAAATCAAGGTGTATTGTGTTAACTGAAGCCGAAAAGAAGAAGAGCAAGCCAGTGATGCAGTGCTTGAGTGGTTTGGCAGAGTTTTTAGACCACATGTCCTTCCTTGACTCCTCACTACACTATCAAGCCTCGCAGTCAGAGGGGTTTTGC[C/T]GACCCCAGGATTCTGGCTGGACCAGTGCAGAGATCAAGAGCGGGATGACTGATGATATTCGGTTAGAGTCTGTCAAGCAGGCCAATAGTGTTAGTGTTGAAGAAGTGCATGCTGTTTTGGAGCATTTGAGTTTTAAGAAGTGCAAGGCTGTAGTGTCTGATGCCTGGGACAGAGTGCAGCAGCTGGAGGCCGAGATCAGAGGAAAAGCTGAGGAGGAGCTCACACTCTCCGTGGCTCCACACAGACAGAGCTTCAGCCTCACACAGACTACACCTTGTGAACCAAGGTAGGAATGAGATTTTTTTTTTTGGGTTAATTTCATTTATATATATCTTTTCATCATGGAAAAAATAATGGATTAGCAAAGCAGTGTTCCTCGGAATGAATGAGTTACCCGTTATATGTTGCCCACCCGTTATATGTTGCACAACTAGTGGCTGATTTAGTTAGGATTATTAGGCTATATCATTGAAGAAATAATTTCATATTGAAGCAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14858
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103733 Nonsense 1687 1778 21 23
ENSDART00000103734 Nonsense 675 766 7 9
ENSDART00000103737 Nonsense 1687 1778 20 22

The following transcripts of ENSDARG00000070568 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26772023)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26132213
GRCz11 3 26263084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGAGGARAAGCTGAGGAGGAGCTCACACTCTCYGTGGCTCCACACAGA[C/T]AGAGCTTCAGCCTCACACAGACTACACCTTGTGAACCAAGGTAGGAATGA
Long Flanking Sequence:
ATTCAGAGTCTGAGGAAGACTTCCTCCCACTGCCAAAAAACAGCAGAGATCCTGCTCAAAGCACTAATGTAGAAACAGCCGACGTGCCTGAAGCTGCCCCCAAAAAATCAAGGTGTATTGTGTTAACTGAAGCCGAAAAGAAGAAGAGCAAGCCAGTGATGCAGTGCTTGAGTGGTTTGGCAGAGTTTTTAGACCACATGTCCTTCCTTGACTCCTCACTACACTATCAAGCCTCGCAGTCAGAGGGGTTTTGCCGACCCCAGGATTCTGGCTGGACCAGTGCAGAGATCAAGAGCGGGATGACTGATGATATTCGGTTAGAGTCTGTCAAGCAGGCCAATAGTGTTAGTGTTGAAGAAGTGCATGCTGTTTTGGAGCATTTGAGTTTTAAGAAGTGCAAGGCTGTAGTGTCTGATGCCTGGGACAGAGTGCAGCAGCTGGAGGCCGAGATCAGAGGAAAAGCTGAGGAGGAGCTCACACTCTCCGTGGCTCCACACAGA[C/T]AGAGCTTCAGCCTCACACAGACTACACCTTGTGAACCAAGGTAGGAATGAGATTTTTTTTTTTGGGTTAATTTCATTTATATATATCTTTTCATCATGGAAAAAATAATGGATTAGCAAAGCAGTGTTCCTCGGAATGAATGAGTTACCCGTTATATGTTGCCCACCCGTTATATGTTGCACAACTAGTGGCTGATTTAGTTAGGATTATTAGGCTATATCATTGAAGAAATAATTTCATATTGAAGCAACTAAAAAAGTCTGTAAACTCTCAAAAAGAGACAAGCAAGAAAAATTTCTTGAAAAATAGGCAATTGTTTCGGTTACCTTGACCATTGTCAATGCCAAGATATCCATGTTAGGACAGGAAGCCATCTTAACTGAAAAAAAATCTGCGCACACTCAAAAATCAGAAAGACACAAGCGAGATGAAGTGACAAGCAATTGTACACACCTATTGGATTGTTTTTAAGGAGCGCTGAGTCTTAAGTTGCCTTTATC
Associated Phenotype:
Not determined