Busch Lab

ZMP

nap1l4a

Ensembl ID:
ENSDARG00000070560
ZFIN ID:
ZDB-GENE-030131-9099
Description:
nucleosome assembly protein 1-like 4a [Source:RefSeq peptide;Acc:NP_001082816]
Human Orthologue:
NAP1L4
Human Description:
nucleosome assembly protein 1-like 4 [Source:HGNC Symbol;Acc:7640]
Mouse Orthologue:
Nap1l4
Mouse Description:
nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24682 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24682
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103704 Essential Splice Site 225 349 9 15
Genomic Location (Zv9):
Chromosome 25 (position 24294396)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23473509
GRCz11 25 23571057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTAGACTGCGAGTGTTTCTAAATTATGCTTTGCACCTATTGTTTTTCA[G/A]TTGTAAGATTGACTGGCATAAAGGCAAAGATGTGACAGTCAAAATTGTTA
Associated Phenotype:
Not determined