Busch Lab

ZMP

cacna1i

Ensembl ID:
ENSDARG00000070522
ZFIN ID:
ZDB-GENE-060503-324
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, alpha 1 family subunit (CANN
Human Orthologue:
CACNA1I
Human Description:
calcium channel, voltage-dependent, T type, alpha 1I subunit [Source:HGNC Symbol;Acc:1396]
Mouse Orthologue:
Cacna1i
Mouse Description:
calcium channel, voltage-dependent, alpha 1I subunit Gene [Source:MGI Symbol;Acc:MGI:2178051]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa15653 Nonsense Available for shipment Available now
sa31334 Nonsense Available for shipment Available now
sa20022 Nonsense Available for shipment Available now
sa10549 Nonsense Available for shipment Available now
sa6897 Nonsense Mutation detected in F1 DNA Not yet available
sa20023 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15653
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 260 1547 6 27
ENSDART00000145615 Nonsense 181 1106 5 18
Genomic Location (Zv9):
Chromosome 3 (position 29386724)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29104763
GRCz11 3 29235605
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATCTTGTCCTCAGCACATCTGGCCTCRCCCTTCCCACACCATATTAT[C/T]AGCCTGAGGAGGATGACGAGCGGCCCTTCATCTGCTCGTTGGCTCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 275 1547 6 27
ENSDART00000145615 Nonsense 196 1106 5 18
Genomic Location (Zv9):
Chromosome 3 (position 29386769)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29104808
GRCz11 3 29235650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATCAGCCTGAGGAGGATGACGAGCGGCCCTTCATCTGCTCGTTGGCT[C/T]AAGATAACGGCATCATGTCCTGCAGCGATGTGCCTGCTCGGAGAGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20022
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 296 1547 6 27
ENSDART00000145615 Nonsense 217 1106 5 18
Genomic Location (Zv9):
Chromosome 3 (position 29386834)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29104873
GRCz11 3 29235715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCCTGCAGCGATGTGCCTGCTCGGAGAGAGGGCGGACGGGAGTGCTG[T/A]CTGGATAAAGAGGACGCTCTTCACCGGCAGGCTCTGGGTCTGAGCGCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10549
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 395 1547 8 27
ENSDART00000145615 Nonsense 316 1106 7 18
Genomic Location (Zv9):
Chromosome 3 (position 29400207)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29118246
GRCz11 3 29249088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATGGATTTCATTATTTTCAAGCTGTATCTCTCCTTCCTGTTCCAGATT[G/T]GATCTTTCTTCATGATTAATCTGTGCCTGGTGGTCATTGCCACTCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6897
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 416 1547 8 27
ENSDART00000145615 Nonsense 337 1106 7 18
Genomic Location (Zv9):
Chromosome 3 (position 29400270)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29118309
GRCz11 3 29249151
KASP Assay ID:
554-4831.1 (used for ordering genotyping assays)
KASP Sequence:
TGATTAATCTGTGCCTGGTGGTCATTGCCACTCAGTTTTCGGAGACCAAA[C/T]AGCGAGAGCACCAGCTGATGCAAGAGCAACGTGCTCGCTACCTGTCCTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5204
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 932 1547 16 27
ENSDART00000145615 Nonsense 853 1106 15 18
Genomic Location (Zv9):
Chromosome 3 (position 29432207)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29150246
GRCz11 3 29281088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGYTTTATTTATTGACTCACAATTTGCATTCTGTGCATTAGTGTCCAGGA[C/T]GAGCATCTCTTTACCACAATTGGGGACGCCCCGCACGGCCAGGAATATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20023
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Nonsense 1431 1547 25 27
ENSDART00000145615 None None 1106 None 18
Genomic Location (Zv9):
Chromosome 3 (position 29462695)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29180734
GRCz11 3 29311576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTAATCCGATGTGCTGATTTCTCTCAGAGGCCCAGAAGTTGCCCTACTA[T/A]GCCAGTTATAGTCATGTACGGCTGATGATCCACACCCTGTGCACCAGTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26075
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085216 Essential Splice Site 1511 1547 26 27
ENSDART00000145615 None None 1106 None 18
Genomic Location (Zv9):
Chromosome 3 (position 29466314)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29184353
GRCz11 3 29315195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTCCTGAAGCTCATCGCATTTGGCTTCCGACGTTTCTTCAAAGACAG[G/A]TATTCAGTTCATTCCCTTACTCGTCTTTCATCTCCTCACGTTTTCTCCAC
Associated Phenotype:
Not determined