Busch Lab

ZMP

LOC555897

Ensembl ID:
ENSDARG00000070507
Human Orthologue:
TRPC4
Human Description:
transient receptor potential cation channel, subfamily C, member 4 [Source:HGNC Symbol;Acc:12336]
Mouse Orthologue:
Trpc4
Mouse Description:
transient receptor potential cation channel, subfamily C, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24873 Nonsense Mutation detected in F1 DNA Not yet available
sa30939 Nonsense Mutation detected in F1 DNA Not yet available
sa9768 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24873
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080789 Nonsense 263 934 2 10
Genomic Location (Zv9):
Chromosome 10 (position 26475386)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25879243
GRCz11 10 25840956
KASP Assay ID:
554-7677.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGTGTAAACAGTTCGCCAAAGACCTGCTCGACCAAACACGCAGCTCC[A/T]GAGAGCTCGAGCTGATTCTGAACTACAAAGATGATATAAATCTTCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30939
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080789 Nonsense 326 934 3 10
Genomic Location (Zv9):
Chromosome 10 (position 26472080)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25875937
GRCz11 10 25837650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCGCGTCTCGCTGGTATGATGAGTTTCCAGGCTGGAGACGCCGCCATT[G/A]GGCCAGCAAGTTCATGACCTGTATCTTCATCGGACTTCTCTTCCCTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080789 Nonsense 777 934 10 10
Genomic Location (Zv9):
Chromosome 10 (position 26465178)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25869035
GRCz11 10 25830748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCCGGTACGAGGTGATGGGAATGATGAAGGGCACTAAAACTGGCATGT[C/A]GACCTCAAAAGGAAATACAGCAGAMTCAAGCCTTGTGTATCCCGAGAACG
Associated Phenotype:
Not determined