Busch Lab

ZMP

FRMD7 (1 of 2)

Ensembl ID:
ENSDARG00000070495
Description:
FERM domain containing 7 [Source:HGNC Symbol;Acc:8079]
Human Orthologue:
FRMD7
Human Description:
FERM domain containing 7 [Source:HGNC Symbol;Acc:8079]
Mouse Orthologue:
Frmd7
Mouse Description:
FERM domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2686379]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32601 Essential Splice Site Available for shipment Available now
sa17945 Nonsense Available for shipment Available now
sa13710 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32601
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Essential Splice Site 46 678 2 11
Genomic Location (Zv9):
Chromosome 1 (position 9518002)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9657788
GRCz11 1 10341899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACAGGTCTGGCTTGAACTCCTTAAACCAGTGGCTAAGCAAATCAAAA[G/A]TGAGTTTTATGCTTATTAAGCTCATTTACAGTAATGGGGAACAGGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17945
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Nonsense 526 678 11 11
Genomic Location (Zv9):
Chromosome 1 (position 9506699)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9646485
GRCz11 1 10330596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGAGGACTAGGGCTGAGGGCTGGGTTGAATAGGAAACTGGACTTGAGC[A/T]GAGTGGAAGCAGGTCATTATAGTGATGACTCCACCTTCCAGACTGGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109141 Nonsense 624 678 11 11
Genomic Location (Zv9):
Chromosome 1 (position 9506403)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9646189
GRCz11 1 10330300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGGCACAAGTAGTTACAGTGATTCAGATTCAGACACCTTCTACCCCTA[T/A]TTTCCCACACTGGGAAAAGTGGTACRTTCTGGWCCATTGGCACGCATGCG
Associated Phenotype:
Not determined