Busch Lab

ZMP

si:dkey-189l3.1

Ensembl ID:
ENSDARG00000070467
ZFIN ID:
ZDB-GENE-061207-53
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CF06]
Human Orthologue:
LACTBL1
Human Description:
lactamase, beta-like 1 [Source:HGNC Symbol;Acc:35445]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13718 Essential Splice Site Available for shipment Available now
sa7351 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103450 Essential Splice Site 48 653 None 8
ENSDART00000136061 Essential Splice Site None 71 None 3
Genomic Location (Zv9):
Chromosome 11 (position 29033778)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27909764
GRCz11 11 28156938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCTTTCAACCATCAACGAAGAAAAGCGTTCCTAAACCAAACTAACAGG[T/A]AAGTTCATGWTAAAATAGATGYGTTTCTTGTGTTTTTGGTTCATGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7351
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103450 Missense 310 653 7 8
ENSDART00000136061 None None 71 None 3
Genomic Location (Zv9):
Chromosome 11 (position 29008947)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27884933
GRCz11 11 28132107
KASP Assay ID:
554-4073.1 (used for ordering genotyping assays)
KASP Sequence:
TCTACCTCGAAGACTCCGTGGGACTAACTTACTGTGGAAAGGCAAGACCA[A/T]GACTGCAATCAACCTCCTACAAGATGATGTGCTCGTAGCAGATCCGGGGA
Associated Phenotype:
Not determined