Busch Lab

ZMP

zgc:158604

Ensembl ID:
ENSDARG00000070463
ZFIN ID:
ZDB-GENE-070112-882
Description:
E2F transcription factor 3 [Source:RefSeq peptide;Acc:NP_001074097]
Human Orthologue:
E2F3
Human Description:
E2F transcription factor 3 [Source:HGNC Symbol;Acc:3115]
Mouse Orthologue:
E2f3
Mouse Description:
E2F transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:1096340]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29223
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103437 Nonsense 44 207 1 3
ENSDART00000130815 Nonsense 44 429 1 7
Genomic Location (Zv9):
Chromosome 19 (position 29776821)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 29706843
GRCz11 19 29294066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCGGTTTCCGATCGACGGTGTGCAGTTTATTCCAATGCTACCCGTATA[C/T]AAATAAACACACCGCCGTCCACTAATAACGGCTGTGTGCCCGAGGCTTCT
Associated Phenotype:
Not determined