Busch Lab

ZMP

GCH1

Ensembl ID:
ENSDARG00000070453
Description:
GTP cyclohydrolase 1 [Source:HGNC Symbol;Acc:4193]
Human Orthologue:
GCH1
Human Description:
GTP cyclohydrolase 1 [Source:HGNC Symbol;Acc:4193]
Mouse Orthologue:
Gch1
Mouse Description:
GTP cyclohydrolase 1 Gene [Source:MGI Symbol;Acc:MGI:95675]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15766 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15766
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103405 Essential Splice Site 116 251 1 6
Genomic Location (Zv9):
Chromosome 17 (position 14990034)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15140862
GRCz11 17 15148795
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGACAGCCATGCAGTTCTTCACCAAGGGATACCAGGAGAAAATCATCGG[T/C]GAGTTKTATGAWTGTGTGWCAACTGTTYAGAAGTGTTTATTTAACAMGCG
Associated Phenotype:
Not determined