Busch Lab

ZMP

im:6909388

Ensembl ID:
ENSDARG00000070446
ZFIN ID:
ZDB-GENE-041008-22
Human Orthologue:
RSPH1
Human Description:
radial spoke head 1 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:12371]
Mouse Orthologue:
Rsph1
Mouse Description:
radial spoke head 1 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1194909]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41385 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41385
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103390 Nonsense 124 232 5 8
Genomic Location (Zv9):
Chromosome 9 (position 17284218)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACTGCAGCTTTGAATTAAAATGTTTTTTTTTTTTTGCAGACATGGA[C/T]AGGGTGCATACACATACCATGACACAGGTTCACAGTATGTGGGCACATGG
Long Flanking Sequence:
TGGTCAGACAGGCAGAGTCAACAGGAGCGAACAATACAACATGGGTAATCCAGTAGCGAAATCCATAAAGTCAGGCAATGATGTTGGCAGGCTTAAAAACACATCAGACATCCCAAAATGATCCAAAATCAAAACACGGGTAAATACCAAAAACAAGAACTGGGAAAACGCTAGTGATACAAGCTGAGATCTGTTGAGGGTGAGGTGTATATATAGTCCTGGATGTCAGTCCTCATGAGCTTTTAGCTGTGTAATCAGTGGTCAACTGGTGTGTGTGTGTGTGTGTGTGTGTGGAGTGCCCTCTAGTGTGTGTGATGTGCACTCAACTTGGTGGCTGTGACACTAACCATATACTTTAGTAAGTACACGTGGTTAATATATATTACTCAGTAGGTAAATGAACAGTTACAGTGTAACAAGGACACATTAACATAAAGTGTAACTTTAGTATTTTACTGCAGCTTTGAATTAAAATGTTTTTTTTTTTTTGCAGACATGGA[C/T]AGGGTGCATACACATACCATGACACAGGTTCACAGTATGTGGGCACATGGATAATGGGTAAAATGGAGTCAGCTGGCGAGCTCATCTATCTGAACCACAGATATCAAGGCAACTTTATCAATAATAATGTAAGTTATGCTCTACAAATTATAATCTGAGCTGAAAACATATTACTATATCTATTTACACTTAGTTACCATCATGAGAGAATAGCATTTAGTTCTAAATGCAGTATCTATACAGTCCCTGACAAAAGTCTTGTCACTTGTGTACAAATTGACCTGAAGTGTAACTGAAATATTTCCTATCAAGATTTTTTATTATGTAAAAAATGGCTCAACAGCTTTTGTAAAAATGTTTCAATGCAAAATAAAACTGTCAAAGTAATGTAATACTCCCAGCTTTGTAAAGCCAATTAAGTCATTTTTTGCAAAGATGGAAGTGTTGTCACCTTGTCATATGAGCTTCACCTATGGACTAATGGATATGACTAATGGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27370
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103390 Nonsense 185 232 6 8
Genomic Location (Zv9):
Chromosome 9 (position 17138792)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16838727
GRCz11 9 16846439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCCAGGCAAGTATGTGTTTGACATTGGTTGTGAGCAGCATGGAGAGTA[T/A]CTCCAGATAGAGCAGGTATGTGAGTTTAAACTATATGCATCATATATATG
Long Flanking Sequence:
AAACTAGGATCTCACAGCACCACTGCTTAGTTTTCTGACATTTTGTATTATTTGCAGTAAATTTGTTTAATTTTTGTATAGGTGACAACTTTTGTCTTTCTAAAATTTGACTATTCTGTCATGATTGAATGATAAATCTTTTTTTCAGTGAAACTAACTTATTTCACTGCATTAAAAATCATCTGGGAGGGTTTTAGCTTTTCATATGAGCTATTTGTAACACCAATTGATTAATTAAAAGTCAGATTAATAATAGCAGGTGTTTGTACAACATAGATAAACGCCAATACTTTTGTCAGGGACTGTATAGTATAAATGTTTAACATATATTTATATGGTGACCTCAAAACCAGAGGAGAGCCTACATATTATTATGTTCTTTATTAACGGCAGCTGTAATTATATGTATTTTACAGTTATTTTCATATAATCTTTTTTTTCTAGCCTTCTGGGCCAGGCAAGTATGTGTTTGACATTGGTTGTGAGCAGCATGGAGAGTA[T/A]CTCCAGATAGAGCAGGTATGTGAGTTTAAACTATATGCATCATATATATGAGATGTAAATTCATGACCTGAAGTGTATTTCAGGTGGAAGAATCTGGCTTCCCAGGGTAAATTTATAAGACAATTGATTCCTGCCTTTTTGTTTTTCTTTGCATGTTTAAACTGTTTTCAAAAACTGGCACTGGTCCTGCTTTATATTAAATGGCCTTTACTATGACAATCAAAATATAAATACAATATATTTGATGTGTTTATAATGTATTGCAGAACACGCCTGGTGCTATTGAGGTAAAGATTTGGTGGTATAGGTTGGTTTAAGGGTGGGTTAAGGTGTAAGGGATGGTCAACAGTGTAATTATAAATGTACTTCTGAAAGAAATTACAGATGTTGTACATGCTGGTTTTTAGTCAAGCATAAGTACAATGTAAAAATATGTATTTACACCATATTAACATTTATATTAATTACTAATTTCAGTGTAAGTTCATTAGTTAAGGCCA
Associated Phenotype:
Not determined