Busch Lab

ZMP

vapb

Ensembl ID:
ENSDARG00000070435
ZFIN ID:
ZDB-GENE-030131-2348
Description:
vesicle-associated membrane protein, associated protein B and C [Source:RefSeq peptide;Acc:NP_99781
Human Orthologue:
VAPB
Human Description:
VAMP (vesicle-associated membrane protein)-associated protein B and C [Source:HGNC Symbol;Acc:12649]
Mouse Orthologue:
Vapb
Mouse Description:
vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI Symbol;Acc:MGI:1928

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa30878 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30878
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103357 Essential Splice Site 20 243 1 6
Genomic Location (Zv9):
Chromosome 6 (position 49535133)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49584814
GRCz11 6 49583467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGAGCAGGTCCTGCTGCTGGAACCGCAGCACGAGCTCAGGTTCCGAGG[T/G]GAGTCCAGAAAGCCCCACACTGACGAGGACTTGCGGATAAAACGCCCTGG
Associated Phenotype:
Not determined