Busch Lab

ZMP

dll4

Ensembl ID:
ENSDARG00000070425
ZFIN ID:
ZDB-GENE-041014-73
Description:
delta-like protein 4 [Source:RefSeq peptide;Acc:NP_001073304]
Human Orthologue:
DLL4
Human Description:
delta-like 4 (Drosophila) [Source:HGNC Symbol;Acc:2910]
Mouse Orthologue:
Dll4
Mouse Description:
delta-like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859388]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9436 Nonsense Available for shipment Available now
sa37051 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9436
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103320 Nonsense 205 683 4 11
Genomic Location (Zv9):
Chromosome 20 (position 28276856)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28348159
GRCz11 20 28247249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGCCACTACACCTGCAACCCAGATGGCCRGTTATCCTGTCTCCCTGGCT[G/A]GAAGGGGGAATACTGCGAAGAACGTAAGCAATCAGAGWTCACAATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37051
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103320 Nonsense 387 683 8 11
Genomic Location (Zv9):
Chromosome 20 (position 28280277)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28351580
GRCz11 20 28250670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGAGAAGGACAATGGACGCAGCTACGCATGTGAATGTCCTTTAGGCTA[C/A]ACGGGTCTTAACTGCGAGAGAAGGATGGACAAATGCACCAGTATGCTGTG
Associated Phenotype:
Not determined