Busch Lab

ZMP

mtmr7b

Ensembl ID:
ENSDARG00000070412
ZFIN ID:
ZDB-GENE-050913-66
Description:
myotubularin related protein 7b [Source:RefSeq peptide;Acc:NP_001025297]
Human Orthologue:
MTMR7
Human Description:
myotubularin related protein 7 [Source:HGNC Symbol;Acc:7454]
Mouse Orthologue:
Mtmr7
Mouse Description:
myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2007 Essential Splice Site F2 line generated Not yet available
sa19458 Nonsense Available for shipment Available now
sa32635 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2007
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Essential Splice Site 367 568 9 14
Genomic Location (Zv9):
Chromosome 1 (position 15237878)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15803046
GRCz11 1 16495983
KASP Assay ID:
554-3245.1 (used for ordering genotyping assays)
KASP Sequence:
CTAGTGTACTACTAGATCCCTACTACAGGACTATCAAGGGATTGATGGTA[G/A]TAACTGATATTTGATTCATGCAAGTGTATATGTCTGTGTGSAACAAACAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Nonsense 385 568 11 14
Genomic Location (Zv9):
Chromosome 1 (position 15234498)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15799666
GRCz11 1 16492603
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATTCATATTAATATATGAGCTTTATTAAAATCTTCTACATACAGATA[T/A]GCTCATCTTGACGGCGACCCTAAAGAGGTTTCTCCAGTCATGGACCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127370 Nonsense 452 568 12 14
Genomic Location (Zv9):
Chromosome 1 (position 15230714)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15795882
GRCz11 1 16488819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTATACTTTTATTTGTTTGTTTACTCATTCATTTTGCACTGTGCAGGT[T/A]ACAGGAGAGAACACACTCTCTGTGGCCACATCTGTGGGAGAACAGAGCTG
Associated Phenotype:
Not determined