Busch Lab

ZMP

zgc:154037

Ensembl ID:
ENSDARG00000070371
ZFIN ID:
ZDB-GENE-060929-168
Description:
hypothetical protein LOC767644 [Source:RefSeq peptide;Acc:NP_001070052]
Human Orthologue:
MYST2
Human Description:
MYST histone acetyltransferase 2 [Source:HGNC Symbol;Acc:17016]
Mouse Orthologue:
Myst2
Mouse Description:
MYST histone acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2182799]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9958 Essential Splice Site Available for shipment Available now
sa18756 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9958
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
Genomic Location (Zv9):
Chromosome 3 (position 33037379)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32768689
GRCz11 3 32900403
KASP Assay ID:
2259-3700.1 (used for ordering genotyping assays)
KASP Sequence:
AAACACTCGCCTCACTCGCTCCTCRYTGAGACTCAGCCGCAGCTCRCAAG[G/A]TAAGACACTGGAAATCACCTWYGTGGAGATCYTGAGTAAAGGTGTGATTG
Long Flanking Sequence:
TGACCGGTAGTGTAAATATGGTTCATTTGCAATTTACACACACTGCAATAATAATAAATTGAATATAATTCTCGTTATGAAAATAAACATTACATAATGCAGGTAAATATCAGCAAAGAAAACCCCTGGTTGATACTCCTGGCACTGAGTAATTAAAAATGCAAAACTCACCAGTGTAAATGTTAGAGGGAAAGTAAACTAAATTATTCTTTCATCTCAAAGTTATCTTAATTACCAGCAGTATTTGGTTAACCTGTAGTAAATGCAGTCTTTAAAGTCATTTTATCTCAATTATTTCAATCTGTATAGTATAATAGGATTTGCGATGAAGCTAGTTTGTGCTGTTGTTGACTCTTAGAGAAATGCTGGCAGCAGTTCTGAAGGCACAGAAGACTCGGACTTCTCGGCTGAACACACAGACAGCTCAGAGAGTGAAGCACACGTGGTTCGAAACACTCGCCTCACTCGCTCCTCGTTGAGACTCAGCCGCAGCTCGCAAG[G/A]TAAGACACTGGAAATCACCTTCGTGGAGATCTTGAGTAAAGGTGTGATTGATTATGCACACAATAATTTCACTTGCTTGTTGGAATAATGAAATTAGCGATTCTATTTTCTGCCCCAAAACAAGTGTGAGAGGGGTTGATAGGCAGGAAGCACAATGAATGGAAAACAAGAAAGAGAAGAATGAACAAACAAACAAACCTGAGAGCTTTGTTTCTAGATGCCAGTCCTGTGAGGAACCCGACTGCCCCAGTTTCAGAGGAGGTGGTGAACTATTCCACTCGTCGAGTAACTCGTAGTCAACAGCAGGGGGCGACCGTCTCACCCAAGAAATACCCCTTGAGGCAGAGTCGCTCTTCTGGCTCAGACACGGAGCAGCATGGGGAAATCTCAGAGAGGGGTAGGAGGAGAAAACCGCACGGTTCTTCACTCATGCCTTCCCTCATTTGAGTCTCTCCATGCTTGGCTCTGCTCATTTGTGTGTCTTCTCATTTGCTTCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18756
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
Genomic Location (Zv9):
Chromosome 3 (position 33037379)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32768689
GRCz11 3 32900403
KASP Assay ID:
2259-3700.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACACTCGCCTCACTCGCTCCTCGTTGAGACTCAGCCGCAGCTCGCAAG[G/A]TAAGACACTGGAAATCACCTTCGTGGAGATCTTGAGTAAAGGTGTGATTG
Long Flanking Sequence:
TGACCGGTAGTGTAAATATGGTTCATTTGCAATTTACACACACTGCAATAATAATAAATTGAATATAATTCTCGTTATGAAAATAAACATTACATAATGCAGGTAAATATCAGCAAAGAAAACCCCTGGTTGATACTCCTGGCACTGAGTAATTAAAAATGCAAAACTCACCAGTGTAAATGTTAGAGGGAAAGTAAACTAAATTATTCTTTCATCTCAAAGTTATCTTAATTACCAGCAGTATTTGGTTAACCTGTAGTAAATGCAGTCTTTAAAGTCATTTTATCTCAATTATTTCAATCTGTATAGTATAATAGGATTTGCGATGAAGCTAGTTTGTGCTGTTGTTGACTCTTAGAGAAATGCTGGCAGCAGTTCTGAAGGCACAGAAGACTCGGACTTCTCGGCTGAACACACAGACAGCTCAGAGAGTGAAGCACACGTGGTTCGAAACACTCGCCTCACTCGCTCCTCGTTGAGACTCAGCCGCAGCTCGCAAG[G/A]TAAGACACTGGAAATCACCTTCGTGGAGATCTTGAGTAAAGGTGTGATTGATTATGCACACAATAATTTCACTTGCTTGTTGGAATAATGAAATTAGCGATTCTATTTTCTGCCCCAAAACAAGTGTGAGAGGGGTTGATAGGCAGGAAGCACAATGAATGGAAAACAAGAAAGAGAAGAATGAACAAACAAACAAACCTGAGAGCTTTGTTTCTAGATGCCAGTCCTGTGAGGAACCCGACTGCCCCAGTTTCAGAGGAGGTGGTGAACTATTCCACTCGTCGAGTAACTCGTAGTCAACAGCAGGGGGCGACCGTCTCACCCAAGAAATACCCCTTGAGGCAGAGTCGCTCTTCTGGCTCAGACACGGAGCAGCATGGGGAAATCTCAGAGAGGGGTAGGAGGAGAAAACCGCACGGTTCTTCACTCATGCCTTCCCTCATTTGAGTCTCTCCATGCTTGGCTCTGCTCATTTGTGTGTCTTCTCATTTGCTTCATCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26102
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083874 None None 128 None 3
ENSDART00000103201 Nonsense 176 606 4 15
ENSDART00000134917 None None 92 None 4
ENSDART00000144026 None None 231 None 7
ENSDART00000145443 Nonsense 176 190 4 4
ENSDART00000148239 Nonsense 176 606 5 16
Genomic Location (Zv9):
Chromosome 3 (position 33035612)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32766922
GRCz11 3 32898636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATCAAGTCTCGCACATCGGCCCAAGCGACGTCGCTTTCACGAGAGCTA[C/A]AACTTTAACATGAAGTGCCCCACTCCTGGCTGCAATTCACTTGGTAATTG
Long Flanking Sequence:
CCATAAAATAATGACTGGTTTATAATTTGGTTTATATTAAAATGAATTCTAAGATAATAAGTCTGTAGTAAGTAAAAAGAAGTTACGCTAAAGCATCACTTATCATTTTATCATTCTGGTATTGTCTTGTTTGTGGTTAGTTGTTTCTTCACTTAAGCTCTAGTTATGGTGTTGCTTCAATCTTCTTTTCATCTGTAGTGACACTACTGCAGTTCATTCCATCATGTGCTGATGTACAATATATGAAACAAATGTATGTTACACTCCTGGACTTTATTAAGTCTGGTTTATTGTTGTATTGGCCATCCAGACATTAAACAAAGCGCAGACCATGATGAGTCCCCACCGCGGACCCCCACAGGCAACGCTGCCTCCTCTGAGTCTGACATTGACATGTCCAGCCCAAACGTGTCTCATGATGAGAGTCTGGCTAAAGAACTGTCACTGAAAGAATCAAGTCTCGCACATCGGCCCAAGCGACGTCGCTTTCACGAGAGCTA[C/A]AACTTTAACATGAAGTGCCCCACTCCTGGCTGCAATTCACTTGGTAATTGGAGTTCAGATTGTTGGTTTTATGATTTACAGTGAATATGTAAAGTACCCTTCAAAAGTTTGGGGTCGAAAAGGATTCAAAAGATGTCTGATAATTAAGAAACAGGTCTCATGATTATCTTCACTGATAATCGCTGCTTAATATTTTTGTGGAAATTGTGATGTATTATTTTCAGAAATGTTTGATCAATACTGAGTTCAAGATTGTTTTTTTTCATAAGTAGGTTAAACTCACAATTTGAATATGAATATAATGAATATAAATTGTATAAAATTAGCGGTAATAAAACTTTGACTTTTCCAAACCGTGGTAAACCTTTAAACCGGTTGTCATCCTATGCCTAATTTGTAAAGTACAAGACACTCAGAGCTTGAACTTGCTACAGCTTAGCCTGAGTTATTTACACATCAACTAACGTTAGTGTTCTGACTCCAAACTTTTGAATGGTAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26101
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083874 None None 128 None 3
ENSDART00000103201 Nonsense 202 606 5 15
ENSDART00000134917 None None 92 None 4
ENSDART00000144026 Nonsense 64 231 3 7
ENSDART00000145443 None None 190 None 4
ENSDART00000148239 Nonsense 202 606 6 16
Genomic Location (Zv9):
Chromosome 3 (position 33034977)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32766287
GRCz11 3 32898001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCATTCCTTTTTCAGGACATTTGACAGGGAAGCATGAAAGACACTTTT[C/A]AATATCTGGATGTCCACTGTATCATAACCTTTCTGCAGATGAGTGTAAGG
Long Flanking Sequence:
GTCTGATAATTAAGAAACAGGTCTCATGATTATCTTCACTGATAATCGCTGCTTAATATTTTTGTGGAAATTGTGATGTATTATTTTCAGAAATGTTTGATCAATACTGAGTTCAAGATTGTTTTTTTTCATAAGTAGGTTAAACTCACAATTTGAATATGAATATAATGAATATAAATTGTATAAAATTAGCGGTAATAAAACTTTGACTTTTCCAAACCGTGGTAAACCTTTAAACCGGTTGTCATCCTATGCCTAATTTGTAAAGTACAAGACACTCAGAGCTTGAACTTGCTACAGCTTAGCCTGAGTTATTTACACATCAACTAACGTTAGTGTTCTGACTCCAAACTTTTGAATGGTAGCCTATTTGGGTCATTTTTGTATTAATAGTGTTCTTTTTTTCCTTCGTGCAGATGTTTACACGTGTAGACTTGTCAAATATTCACCCTTCATTCCTTTTTCAGGACATTTGACAGGGAAGCATGAAAGACACTTTT[C/A]AATATCTGGATGTCCACTGTATCATAACCTTTCTGCAGATGAGTGTAAGGTATGGTAAATCTTATGTCTGCTTCTGAGCTAAACCTTTTAGTAGATGATATTTAGCTAAAACAGTAAGGTTTACATAAAACCAGCTGTAGCTACCCGCTAGTTATTAAGACAGTCCACGCTTCCCAAATACTGATGTCCATGCGTTTCATTTATTGAACACCATGAAAACTAAAAGATAAACAAATAAAAAAACCAAATGCATCATACAAACACATTCAAAAGAACATCAAAATAAACAAATAATTTACAAACAATGTTTCTTTTACTGTGTTGGCCTGATATAACCAGCAGTAGAATAATCAGGAGCAGTTAACAGGTGCCTGCATTGAGGTCTCACTATGCTGTTTATACAAACTCTCACAAGTTAAATCAATCAAGGCAACCGGAAACAAGGAAATTTATAACATAATCCAATACTCTTTCAAATAATGAAATACAAAAATACAAGC
Associated Phenotype:
Not determined