Busch Lab

ZMP

si:dkey-245p14.4

Ensembl ID:
ENSDARG00000070320
ZFIN ID:
ZDB-GENE-061207-63
Description:
hypothetical protein LOC563576 [Source:RefSeq peptide;Acc:NP_001108320]
Mouse Orthologue:
AC127332.1
Mouse Description:
predicted gene 7271 (Gm7271), non-coding RNA [Source:RefSeq DNA;Acc:NR_033501]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24841 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18693
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103089 Essential Splice Site 95 183 2 3
ENSDART00000103089 Essential Splice Site 95 183 2 3
Genomic Location (Zv9):
Chromosome 1 (position 18277564)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18842732
GRCz11 1 19535669
KASP Assay ID:
2259-0438.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGGGCCCTGACAGATCTGCTGATTTTGGATGGTAGAGATCCAGATACC[G/A]TGAGTTGAGCTCTGTCGAAATCTGATAAATGCTGCTAATTAGGGCTGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3376
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103089 Essential Splice Site 95 183 2 3
ENSDART00000103089 Essential Splice Site 95 183 2 3
Genomic Location (Zv9):
Chromosome 1 (position 18277564)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18842732
GRCz11 1 19535669
KASP Assay ID:
2259-0438.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGGGCCCTGACAGATCTGCTGATTTTGGATGGTAGAGATCCAGATACC[G/A]TGAGTTGAGCTCTGTCGAAATCTGATAAATGCTGCTAATTAGGGCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24841
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103089 Nonsense 111 183 3 3
Genomic Location (Zv9):
Chromosome 1 (position 18278740)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18843908
GRCz11 1 19536845
KASP Assay ID:
554-7457.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAGGATGATCCCTGTTTCTTGATGCATTTCAACTCGGTGCGGCCCATC[A/T]GAGCAGTGAGCTGTGCGGCCAAATACACCCTGGCCCGCTGTCTGCTGTCC
Associated Phenotype:
Not determined