Busch Lab

ZMP

irge4

Ensembl ID:
ENSDARG00000070317
ZFIN ID:
ZDB-GENE-051212-2
Description:
immunity-related GTPase family, e4 [Source:RefSeq peptide;Acc:NP_001076501]
Mouse Orthologues:
AC132320.1, Gm4841, Ifi47, Igtp, Iigp1, Irgc1, Tgtp1, Tgtp2
Mouse Descriptions:
T-cell specific GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:98734]
T-cell specific GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:3710083]
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma induced GTPase Gene [Source:MGI Symbol;Acc:MGI:107729]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
interferon inducible GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:1926259]
interferon-inducible GTPase-like [Source:RefSeq peptide;Acc:NP_001094945]
predicted gene 4841 Gene [Source:MGI Symbol;Acc:MGI:3643814]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa28662 Nonsense Mutation detected in F1 DNA Not yet available
sa194 Nonsense Confirmed mutation in F2 line Not yet available
sa28661 Nonsense Mutation detected in F1 DNA Not yet available
sa23 Nonsense Confirmed mutation in F2 line Not yet available
sa18438 Nonsense Available for shipment Available now
sa24 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 27 713 1 7
Genomic Location (Zv9):
Chromosome 16 (position 28067360)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25913047
GRCz11 16 25828079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGACCCTGCTATTGCTGAGGCAGTGCAGGCCTCTGGTGAATCAACCT[T/A]GGAAAAGGCCACAGCAAAAGCCAAAGAAAGTTTTGACCAGTTTATGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa194
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 122 713 1 7
Genomic Location (Zv9):
Chromosome 16 (position 28067075)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25912762
GRCz11 16 25827794
KASP Assay ID:
554-0107.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATAGGAAGTCCAAACTTCAAAGCAGATAAATACCTTAAAGATGTCAAAT[T/A]AAAAAATTATGACTTCTTCATTATTTTGAACTCCGAGAGGTTCATGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28661
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 229 713 2 7
Genomic Location (Zv9):
Chromosome 16 (position 28066743)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25912430
GRCz11 16 25827462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACACACTAGCAGAAGAGCTTCCAGTCCATAAGAGAAATGCTCTCCTA[C/T]AAGCCTGGCCGGTGTGCTCTGCTGCATCTTTGGAGATGAAGATCAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 231 713 2 7
Genomic Location (Zv9):
Chromosome 16 (position 28066736)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25912423
GRCz11 16 25827455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAGCAGAAGAGCTTCCAGTCCATAAGAGAAATGCTCTCCTACAAGCCT[G/A]GCCGGTGTGCTCTGCTGCATCTTTGGAGATGAAGATCAAGATGTTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 333 713 3 7
Genomic Location (Zv9):
Chromosome 16 (position 28066236)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25911923
GRCz11 16 25826955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAAGAGGTGCTGGACAGTGTTCGATAGCTCRTAGATGTCCGGTAATTG[T/A]ATTTTTGGAAAAAAGTGTTGTTTTTTTKATTGCTTTAATTGGTTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4660
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 Nonsense 17 385 3 3
ENSDART00000086303 Nonsense 416 713 7 7
Genomic Location (Zv9):
Chromosome 16 (position 28063411)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25909098
GRCz11 16 25824130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATGACAGATGATTCTTCTGCTGACATGAATTTCTCTGGAGCTTTGCAG[A/T]GATTGGGTGAAAGTGACCCAAATGCAGCTGCTGTGAAGGCTAAAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28660
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 Nonsense 162 385 3 3
ENSDART00000086303 Nonsense 561 713 7 7
Genomic Location (Zv9):
Chromosome 16 (position 28062974)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25908661
GRCz11 16 25823693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAGAAGAGGTTTTATTTTGTTCGAAACAAGATTGATAATGACATTTG[C/A]TCAGTAGCGAATGGAAAAATCAACGAGCAGCAGCTGCTTTGCGCAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 Nonsense 168 385 3 3
ENSDART00000086303 Nonsense 567 713 7 7
Genomic Location (Zv9):
Chromosome 16 (position 28062958)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25908645
GRCz11 16 25823677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTTCGAAACAAGATTGATAATGACATTTGCTCAGTAGCGAATGGA[A/T]AAATCAACGAGCAGCAGCTGCTTTGCGCAATCAGGGAAGACTGCTACAGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461