Busch Lab

ZMP

rhot1b

Ensembl ID:
ENSDARG00000070316
ZFIN ID:
ZDB-GENE-061009-52
Description:
mitochondrial Rho GTPase 1 [Source:RefSeq peptide;Acc:NP_001076295]
Human Orthologue:
RHOT1
Human Description:
ras homolog gene family, member T1 [Source:HGNC Symbol;Acc:21168]
Mouse Orthologue:
Rhot1
Mouse Description:
ras homolog gene family, member T1 Gene [Source:MGI Symbol;Acc:MGI:1926078]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9381 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9381
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051815 Nonsense 103 660 6 20
Genomic Location (Zv9):
Chromosome 6 (position 19336766)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22102305
GRCz11 6 18573626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATAATTTCCTTGTCACAGGTCACAAGTCATTGGATTCCCCTGATAAAT[G/T]AGAGGACAGACAAAGATAGCAGGTTGGCAGCTGGATGTATTTGTGGTTCA
Long Flanking Sequence:
GTGATAAAGGCAGATTGGCATGCAGTTTTGTAAACACTCTGAAAGTTATTCCAATGAAAGTAAACCTTGACACTGAACTGAATGAAAAATACTTTTTTGCTGATCCTTGCTGCACTGTATTAATTGGTTGCACAGAGGAAAAACTACTAAAGTAGTAAAGAATGCCAAAGATGTAACAAATCAAGCAGAAGGGAGCCGATTACATTCAGTTTGTCAAAACAATACACCATTTTCTGCATGCCAAGTCCTTCTGTGATTGATTCACTGTGCTGCCCATGCTGTTGTTTACATCTGAATTTTTCCATAATCTCCATGTGGGTAAATGATCAAATCTGTACGCAAGTGGAAACACTATTGCTATGTGTTTTTTACAGTTTGTTTTTACAGTTTACAGTTTGTTGTTGTGAACAGGTCTTAAAATATATGTCTCTAGCTCTCATATTTTTAAAAACATAATTTCCTTGTCACAGGTCACAAGTCATTGGATTCCCCTGATAAAT[G/T]AGAGGACAGACAAAGATAGCAGGTTGGCAGCTGGATGTATTTGTGGTTCAGTGTGCGGCATTTGTTCAAAAAATGTTACATGTTCCTTTTAATTACAATGAATTTTAACCATATGCAGTATCATGACCAAATATTTTCAATAGGAAAAACTTGTTGATTGTGCTTAAATTGTTAGTTCTTTTCATACTAAAAATGGACTATGCTTGCTTACCTTTAACTCCTTGATTTTATGTTTGTTTAAGGGTTCCTCTTATTCTTGTGGGGAATAAATCTGACCTAGTTGAGCACAGCAGTATGGAAACTGTCCTCCCCATCATGAACAAATACACAGAGATAGAGACATGTGTAGAGGTATGTTAAGCCATGCATAGTCACATCTTATTGGGAACATGTTTATGTGAAAACCCAGCAATGGTTAATGTACTTTCAGTGCTGGGTTGTGGCATCCACCACATAAAGCATATGCCAGAGTAATTGGCAACTCATTCTGCTGTGGCAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26722
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051815 Essential Splice Site 513 660 17 20
Genomic Location (Zv9):
Chromosome 6 (position 19321468)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22117603
GRCz11 6 18588924
KASP Assay ID:
2259-7395.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTCAGCAACCCCTGTTCTTTTGAGTACTGTGCACAAATCTTTAAGG[T/C]TTGCCTAATATTATATTGTTCACAAGACATAGCGTCACTAGACATGCTGT
Long Flanking Sequence:
TCTCTGCTAGTTCTGATGATATCTATGCAGTCATCATGACTTCTGTTTCTTTAAGCTGTTGCTGTTTGTTTCTCACAGCATCAAAGGGCCATAAGAGAGGAACATAAATCATACTACGCAATCAGCACTGCGCATGTTTACGGACAGGAGAAGTACTTGTTGGTAAATAGTTTTGTGTCTTACAGGATCTTACGCATTACAGATAGTTTGTTTTTTCAGTGTAAGGAACCATTATTTAGTTAAATATTGCAGTTTTTCAAGCATGTGTTTAAGCCACATGAAGAGTTCAGCAAAATCACCACTGTTTGGTAATCGTCATTATTCTTTGTTTCATTGAAAGCAAACCGAATTTTAAAACTTATTGTTTTTCCTTCAGCTCCATAAAGTCTTCCCAGATTTTGATTTCTTGTCTGAGATGGAACTTACATGTGACGTTGCGTGTCTGATCTATGATGTCAGCAACCCCTGTTCTTTTGAGTACTGTGCACAAATCTTTAAGG[T/C]TTGCCTAATATTATATTGTTCACAAGACATAGCGTCACTAGACATGCTGTGTTCTACATAAATTGTGATATTTACTTTGTTTTGTTGTAGCATTCTGACATGTATGTTTGCTTTGGTTTATTTACCAGCAATACTTCATGGACAGTAAGACTCCATGTATGTTGATTGCTGCAAAGTCAGACCTGCCAGAGACAAAGCAGCAATACGGTATGACTCCACTTGAGTTCTGCCGCAAGCACAAGATGCCACCGCCTCAGTCTTATACCTGTAACACTGCTGGAGCTCCCAGCAAAGACATCTTCATCAAACTTGCCACCATGGCTGTGTACCCGTAAGTGTGCTTTTATTATTTACAATTCAAGTATTTAAACTCTGTTTTGATAGATTTGAAAGACCACTGTTTAATTTGTCATCTCTCTTTGGGTTATTTCCATGACATTAAAGCTAGCACATGGTTAGTTTGTTCACTCAGGCTAAAAATGATGTCAGAAACCCCTTCT
Associated Phenotype:
Not determined