Busch Lab

ZMP

crlf3

Ensembl ID:
ENSDARG00000070261
ZFIN ID:
ZDB-GENE-050417-354
Description:
Cytokine receptor-like factor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q568M3]
Human Orthologue:
CRLF3
Human Description:
cytokine receptor-like factor 3 [Source:HGNC Symbol;Acc:17177]
Mouse Orthologue:
Crlf3
Mouse Description:
cytokine receptor-like factor 3 Gene [Source:MGI Symbol;Acc:MGI:1860086]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10525 Essential Splice Site Available for shipment Available now
sa40110 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10525
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Essential Splice Site None 444 None 9
ENSDART00000147712 Essential Splice Site None 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35897424)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35682620
GRCz11 3 35812128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGAACTCCGCGGCAGAAGTTAATATGACACAAGACAGGATCGCTTAAGG[T/C]ACTGTTAAAAAATAACCGCCTATGTTTTTGCTACACTTYATCATTCATTG
Long Flanking Sequence:
ACATATTACTATTAAAAAACGTGGTTTATTTTCGTACGAGTAAAAACGCAAAATAAAACACATTAGCCAAATAAACAAACCTGCTTTCATACTTTCTGCTTTCACAGAAGTTTTGTATTCCGCATTTTGATAAAGTTGCCTGTAAATAACTCTGTTGAAAGTGTTGGACTTTGGTACTTCTCCATAATCAATAAATACGCACAAGACAATCAGTTTTACTTTGTGATAAACACAATCTGACGCCAGGGAGCTCTGCATTGACGCCTTCGTGTGCTTTGGGTTTTTAACAAAAGATGAGGCGGGGACAGAAGAAGTTAAATCATCTGATTGGCTAAAACTGACAGTAGACATGAGGAAAACACAGCGATGCGGCCTCTGATTGGATGAGGGGTTTGTATCAAAGTGAAAATATGTGCCTCAAGCCCTTTACTGTTGCCAGGGCGTCAATGGCGGAACTCCGCGGCAGAAGTTAATATGACACAAGACAGGATCGCTTAAGG[T/C]ACTGTTAAAAAATAACCGCCTATGTTTTTGCTACACTTCATCATTCATTGCTTAAATATTCGGTCTCCAAATAATCATGTGTATGGGTGGAGTTTTAAGAGCTTACATTAAAACTCTGAAGAGTAAAAGTGATGATGAGTGTTGGTGTGGCAATACTCGCTGAAGAGCCTCGTGAACTGCCACTGCTGCTGCTGCTTTATGAGTTTCAAAATAACTACTTATATTTTCATTTTGTGAGCTGTTTTTCAAAACTTATTTTTATATTTGATCTTATACATCTTTACCATCTCTACTACCTTTAATCTCCTTACGTTTGCCTTTTATTTTCATTTGTTTTGGACTTGTTTACACCTCTTGAGTGTTCACGATGCATCAGTTTGGTCCATAGAGAATTGCTGCACGTTTACATAACTGTCCTCTAATACTCTAATGTTTTTATGTAAGAGCATAACTGTAAAGCTGATGGATAAGCAATAGTTCTGGGAGTTTATAAATAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40110
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Essential Splice Site 39 444 None 9
ENSDART00000147712 Essential Splice Site 39 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35902445)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35687641
GRCz11 3 35817149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGAACTACAGCAGAGACTGCATGGACTCAGTCAGGCACGCAAACAGG[T/G]ACGAGTCTCTGCACTGCCACTGAAAGAATAAATCAGTGTCAGCAAAAGCA
Long Flanking Sequence:
CATCCGTTTGCGCAGAACTTTAACAGATAAGGCTGCGAACGTTATTATGATTCAAAACACGCTTCCCTTGCCTCCACATGAAGTGGAAACGATGGCCTGATTTTTCATAATGTTGCTGTTAAATTTTTATGAGTGCTGACCATGAGAAACAGGCCCATTTTTGGGGGAAGGGGGCTTATGTGGAATTTTATACTCCTGTTTTTTATTATTTTAGCTTTGTTACTGTGACATTTTCCGAAATGGGTGTGTCTTGGCTTTTTTTTTTGTCTAAGGTTTTCCATAGTGAAACATCCAGTCAAACAAAAAAGTTATCGCTATCAGTGGAAATGTTTTCTTGCACTTTACCTTGGTATTTGTGGTGCTTTTGCAGAGGTCAACAAGGATGTCAATAGAGGCAGAGGCGTTGCTGCAGGAGGCAAAGGAGAGCATTGAGGCGGCCCAAAACTACAGAAGTGAACTACAGCAGAGACTGCATGGACTCAGTCAGGCACGCAAACAGG[T/G]ACGAGTCTCTGCACTGCCACTGAAAGAATAAATCAGTGTCAGCAAAAGCAGTTGGTGTTCAAATCGTGGGAGTGTTTTGGTGAAATTTGTTGATTGCATTTGTGTAAGAGTTGAAAATGGAGACGTGAAGTCGGTCTGCTCATGTAATGTTTGCATACTTTTGTCACAGATGATGTTGATTAGATGCAGTACTTGTCAAATACGCAGAGTTTCAGATATTCTCATGTAGCTACAATAACACTTTATTCAGTACTCTATATGCCTTTAAGGGACTTGCATAGAAGTCAGAAACCCTTGTTATTAGTGAAAGTGGTGGCTGTTAAGTGAACTGTACGCAACAACTTATTGCTCATGCTTGCACTCGTGCACATGTACTGTATAGAGTGCACTGAGTGATCATTGTACCCCATGGCTAGGCCCACACGGAATCTGCGCATGCAGATTTTTTAGCCCATCATTAATTCTGTTTATTTACTTCTGTAAATGTGTGTAAATTCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8133
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Nonsense 195 444 5 9
ENSDART00000147712 None None 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35922962)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35708158
GRCz11 3 35837666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCCAGATTGAGGAGCTGGTGGAGAGACCAGGTGGTGTGCTGGTGCGTTG[G/A]TGTAAGGTGAGNNTGAAGACCACATTYATGTCCATCAGACATTTTCTTCCCC
Long Flanking Sequence:
TCAATTTAGAGTACAAATTGACAATAAAAAAAACATACAAAACTTAAAGGGATAAAAAGGGAAAAAAGTGGAGCACATGTTGTTTTAATTAGAAGCAAATGGCCTGCGGGCCGGTAGTTTGAGACCTCTGGTATATAATAAACCCAAAAATAAAATGGTGTTAGACCATAATGTAAATTAAAATTGAAATTATGATTACAATTATTGAAAACCATTTGCTCCAGTTAGTAAAAAAATTACTCTACAGCTTCATGTTATAAATAAATCCTATCAAACACTCAACACCCTGATCGGATGCTTTCTTAACTGGATATTTTGTGTGTCTTCAGTCTGCCGGAGGTACCTTCACTGGTGGACGTGCCGTGTCTGTCCGCGCAGCTGGACGACTCTCTGCTGCATATGTTTCGTGCTCATGTGGCTCGGCATGGCAGTGTAGCGTCTCATCCACCCGTCCAGATTGAGGAGCTGGTGGAGAGACCAGGTGGTGTGCTGGTGCGTTG[G/A]TGTAAGGTGAGTGAAGACCACATTCATGTCCATCAGACATTTTCTTCCCCATGTGACTCTGTTAGAAACCTGAGCTGATTTCCTATAGGTGGACGATGACTTCAGCCCTCAGGATTACCGGTTGCAGTTCCGCCGCAGTAACTCTTCACAGTACGAGGATGCGTATATTGGGAAGGACACAGAGTTCCTGGTGCTCCACCTCGACCCACACGTTGACCACCTGTTCCGTGTGTGTGCCAGAGGAGAGGGGCGGACGGAATGGAGCCCATGGAGCATCCCACAGACCGGCTACACCACACTAGCACCTCACGGTACAAACTCAACAAAACCTACCACTGCAAATCTTTGCCAATGTTATATTAAGCGTCTTAATAAATTGCTAAATGTTCCAGGAGAATGTTTTTCTGTTTTTTTTACACCATAGAGATTTTGATCAGTTCATCTTTTTTGCCAAATTATTATGTTAGAAAATCTGTTTTAAAAGCTTAATAGAAGAGTAA
Associated Phenotype:
Not determined