Busch Lab

ZMP

suz12a

Ensembl ID:
ENSDARG00000070256
ZFIN ID:
ZDB-GENE-040801-36
Description:
Polycomb protein suz12-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DC03]
Human Orthologue:
SUZ12
Human Description:
suppressor of zeste 12 homolog (Drosophila) [Source:HGNC Symbol;Acc:17101]
Mouse Orthologue:
Suz12
Mouse Description:
suppressor of zeste 12 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1261758]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20077 Essential Splice Site Available for shipment Available now
sa1522 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26109
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102952 Essential Splice Site 73 657 2 16

The following transcripts of ENSDARG00000070256 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35949026)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35734222
GRCz11 3 35863730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAACCAACTCAAATATACAGATTTCTTCGCACAAGGAATCTCATAACT[G/T]TAAGTAGGCTATAATCAATGATATTATGTCATTTATATTGTTTATAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20077
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102952 Essential Splice Site 164 657 7 16

The following transcripts of ENSDARG00000070256 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35944444)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35729640
GRCz11 3 35859148
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATATTTTAAAAGCCTCTGTAAAAATGTGCTAATTTTCATTCTGTTTTA[G/A]GATGTGACTTGTCCAGTGAAGCAAGTGCCTACGGGTAAAAAGCAGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1522
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102952 Nonsense 388 657 11 16

The following transcripts of ENSDARG00000070256 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35943119)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35728315
GRCz11 3 35857823
KASP Assay ID:
554-1446.1 (used for ordering genotyping assays)
KASP Sequence:
TTAGGCACTGATCTACCAGTTAGAAGAGAACAAACTCACATTGAACCTTG[T/A]CAGAAACTACATGTTTATTATCAGGTGAGTAATAAGCATCTATAAATTTA
Associated Phenotype:
Not determined