Busch Lab

ZMP

slc41a1

Ensembl ID:
ENSDARG00000070214
ZFIN ID:
ZDB-GENE-030131-4700
Human Orthologue:
SLC41A1
Human Description:
solute carrier family 41, member 1 [Source:HGNC Symbol;Acc:19429]
Mouse Orthologue:
Slc41a1
Mouse Description:
solute carrier family 41, member 1 Gene [Source:MGI Symbol;Acc:MGI:2444823]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44746 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44746
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102870 Essential Splice Site 483 544 9 10
Genomic Location (Zv9):
Chromosome 11 (position 39117977)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37684996
GRCz11 11 37952201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCACTTACATCTTCATTGCTTTTTACCTGGCTGCTGCTCTACTACAGG[T/C]ACACCTGAACATCTGCTTATTATTACAAGGAAATAATCTGGGCTTCAAAA
Associated Phenotype:
Not determined