Busch Lab

ZMP

Q2LK78_DANRE

Ensembl ID:
ENSDARG00000070208
Description:
II-FBPL [Source:UniProtKB/TrEMBL;Acc:Q2LK78]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20846 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102852 Nonsense 27 204 1 4
Genomic Location (Zv9):
Chromosome 7 (position 1973471)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1676480
GRCz11 7 1812560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCGTCCAGTTTTGGGTTTTGGTCTGCAGAAAGAGCCGTCGATGGTTCT[C/T]GAACTGGGCCAAAGTTATGGTCAGTGTGTTCGTCCACCGCTAACCAAAGT
Long Flanking Sequence:
ACATGCGAACTCCACACAGAAATGTAAACTGACCCGGCCAAGGCTTGAACCAGCGACCTTCTTTCTGTGAGGTGACAGCACTACCTTCTGCGCCACCGCGTCAAGCCCCTTTCAGATCATCAGATCATGAGAAATTTCAAGAGTTCAATCAAAGCAAGGTGAATCCTTCTTCAGCTACTGCATCCCTCGCTGCTGGAGTTTGTGTCACCAATTTACTGATTTTGTTTGAAAAATAAATTCTACAGGAACAAATTGGGTGAGAGTTCTGATGGCAGATAAAGTTTGGGTAAACTATCCCTTTAAAGAGCAAATTATATTACTGGAAGAACATTTGTTACTAACCTTAAAACAACCTTTTCAGAACATTTTGAGAACATTCGTTGTTTGCTGGAATCATAATTTTGTTCCTTTTTTCTGCAGATAATCTGGCGCTAAAGAGAAACGCCTCTCAGTCGTCCAGTTTTGGGTTTTGGTCTGCAGAAAGAGCCGTCGATGGTTCT[C/T]GAACTGGGCCAAAGTTATGGTCAGTGTGTTCGTCCACCGCTAACCAAAGTAACCCGTGGTGGAGGGTGGATCTGGGGGACGTTTACCGCGTTAGCAGAGTAATCATCACTAACATTAACAACAGCGTCGCAGACCGAATAAACGGAGCCCAGATTCACATCGGAAACTCTCTGGAGAACAACGGCACCAACAACCCCATGTGAGACGCTCCTTTCATTAATACATTACAGTTGAAGTCAGAATTATATATGTTGAAGAAAAGTCTTTAACCCAAATGAAGGAGTTCAAGTATCTTGGGGTTTTGTTCATGAGTGAGGAAAGGATGGAGCGTGAGTGTGATGCAGCAGCAGTAATGCGGTCGATGTACCAGTCTGTTGTGGTACAGAAGGAGCTGAGCAGAAAGGCAAAGCTCTCGATTTACTGGTCAATCTACATTCCTACTCTCACCTATAGTCATGAGGTTTGGGTCATGACCAAAAAGACAAGATCTCTGATACAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26863
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102852 Nonsense 151 204 3 4
Genomic Location (Zv9):
Chromosome 7 (position 1978992)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1689817
GRCz11 7 1825897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTTTGCAGGTCCGTGTTGGAAGCAGTCGTTGGTAAAACTG[A/T]AGCTCAACTCTAGCTTTAGTCTTTCTGATGTGCAGCTCCTGACCCAGGTG
Long Flanking Sequence:
AAATGCAGCCATGCGTACCTCCGGCTACATAATTCGCAGTATCCAGAAACTTCTGCGGGACTACACTTTCAGAATGAGCCTGTGTTGGACAAACTGCAAGCTTTGGATGTTTTTTTTTTTTTTTCTAAACAAATGTTGTCCCTGTTTTGGAGCACACTAAATTATAGATATCCTTAAAACTAAAAATACTGATACTAACATCTAATACTATTGTGTTTTAATGTCATAGGAGCTTTTAAGCCAGTTTTATGAATGGATAATTTCCAAAATGCACCCACAATTCTGAGATGAGTGTAGTTTTAAATGAAAGTTTAAAGATATTGTCTCAGATATTGTCAACAAACATTTAATGTCCGAATCAAAACATTCAATGCCAATGACAGAAAATGCAGAATTGTAAGATTTATTAACTGATAGTTTCTGTTGCATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTGCAGGTCCGTGTTGGAAGCAGTCGTTGGTAAAACTG[A/T]AGCTCAACTCTAGCTTTAGTCTTTCTGATGTGCAGCTCCTGACCCAGGTGAGACACGCAAACATTCTCCAGTCTGACATGACAACATTACTATCAGGGCTCTAATTTATACAACTTTGTGTGGAAAATTGAAGAGTGAACATACATCAGAATGCTGAAGTTAGTGTAAGCAAAAACTTTGATATTTACATAATCTTGTGTACAAACATCTTCATGCATCTTTGGATTTATACACCACGGATGATTTGAGAATTTGTGTATGTGGAAAAAAAATGTATATATACACTGCCGATTCGAGTTTTAGGAAACAGCAGATAATAACTGGACTTCTAGTTGATGATTTGGCATCAGAAGTGTCTTATATGAAAGGTAAAGGCCTCTAGATTTTGCTTATTTGAGCTCAATAAAGTCTGATCATGTCTCGATGTTGACTGATTTGATTAGGACAGCTCTGCTCAGACTAAAGTCTCATCACTGAACAGAAATAATGTCCAGTATAGA
Associated Phenotype:
Not determined