Busch Lab

ZMP

slc25a13

Ensembl ID:
ENSDARG00000070172
ZFIN ID:
ZDB-GENE-080319-2
Description:
Novel protein similar to vertebrate solute carrier family 25, member 13 (Citrin) (SLC25A13) [Source:
Human Orthologue:
SLC25A13
Human Description:
solute carrier family 25, member 13 (citrin) [Source:HGNC Symbol;Acc:10983]
Mouse Orthologue:
Slc25a13
Mouse Description:
solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13 Gene [S

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43336 Nonsense Mutation detected in F1 DNA Not yet available
sa36899 Nonsense Mutation detected in F1 DNA Not yet available
sa43335 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43336
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102780 Nonsense 201 667 5 20
ENSDART00000141163 None None 103 None 3

The following transcripts of ENSDARG00000070172 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 42312031)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41755354
GRCz11 19 41340409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGACATCATGGTGACCATCAGACCTCACATGCTCACTCGGTTTGTGGAG[G/T]AAAGTCTTGTCGCAGTGAGTTTTTCAGTCAGTGTTTTTACTGTATTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36899
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102780 Nonsense 307 667 8 20
ENSDART00000141163 None None 103 None 3

The following transcripts of ENSDARG00000070172 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 42295060)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGAGATGATTGCACCTCTGGAGGAGGGAGCGCTTCCTTACAACCTTGCT[G/T]AGATTCAAAGACAGGTATGTTTCAGATATAGACCTGGGAAAATGGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43335
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102780 Nonsense 371 667 10 20
ENSDART00000141163 None None 103 None 3

The following transcripts of ENSDARG00000070172 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 42284893)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41736836
GRCz11 19 41321891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCATGCAGAACCAGCGCTCTTCAGGGTCCTTAGTGGAAGAGCTCATGTA[C/A]AAGAACAGCCTGGACTGCTTTAAGAAGGTCGTGCGCTACGAGGGCTTCTT
Associated Phenotype:
Not determined