Busch Lab

ZMP

ubr2

Ensembl ID:
ENSDARG00000070164
ZFIN ID:
ZDB-GENE-081107-29
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JR95]
Human Orthologue:
UBR2
Human Description:
ubiquitin protein ligase E3 component n-recognin 2 [Source:HGNC Symbol;Acc:21289]
Mouse Orthologue:
Ubr2
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 2 Gene [Source:MGI Symbol;Acc:MGI:1861099]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6283 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14897 Nonsense Available for shipment Available now
sa42121 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6283
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102748 None None 952 None 26
ENSDART00000108517 None None 492 None 15
ENSDART00000114040 Essential Splice Site 533 1730 13 47
Genomic Location (Zv9):
Chromosome 13 (position 2989160)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3166579
GRCz11 13 3299929
KASP Assay ID:
554-4430.1 (used for ordering genotyping assays)
KASP Sequence:
GAAGCTCACACATATCATCTCCATGATGCAGGAGTGGTGTGCCAGTGACG[T/A]GAGTTAATGCATACMYACAAACTACTACTCMCTCCTTACAATGACTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14897
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102748 Nonsense 773 952 22 26
ENSDART00000108517 Nonsense 313 492 11 15
ENSDART00000114040 Nonsense 1551 1730 43 47
Genomic Location (Zv9):
Chromosome 13 (position 2959375)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3136794
GRCz11 13 3270144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGGTGGAGAAGTGGTTGAATAGCTGTTGTTTGTGCTGTGCAGGTGGTG[T/A]TCTCATCCAGCTCTTCAGGCYCTTCAGAGCAGYRTGACTCTCATCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42121
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102748 Nonsense 816 952 24 26
ENSDART00000108517 Nonsense 356 492 13 15
ENSDART00000114040 Nonsense 1594 1730 45 47
Genomic Location (Zv9):
Chromosome 13 (position 2958694)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3136113
GRCz11 13 3269463
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTCATCAACCAATCAATTGATCATCTGTTGATCCTGGCTCCTAGGTG[T/A]CCTAAATCTGGAGGAGATAAGTCTCGCGTTCCTACTCTGTGTCTGGTGTG
Associated Phenotype:
Not determined