Busch Lab

ZMP

tgm2

Ensembl ID:
ENSDARG00000070157
ZFIN ID:
ZDB-GENE-040912-78
Description:
transglutaminase 2 [Source:RefSeq peptide;Acc:NP_001004647]
Human Orthologue:
TGM2
Human Description:
transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
Mouse Orthologue:
Tgm2
Mouse Description:
transglutaminase 2, C polypeptide Gene [Source:MGI Symbol;Acc:MGI:98731]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37788 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4226
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102712 Essential Splice Site 359 679 9 13

The following transcripts of ENSDARG00000070157 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 43632505)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43372243
GRCz11 23 43264847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCCCTGATAATTGCAATATAAACACCTGCCATTTGTTTTCCTCCTKTC[A/T]GGCGTATTCTGTTGTGGACCAGCCTCTGTGAGAGCTATTAAAGAGGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37788
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102712 Nonsense 524 679 10 13

The following transcripts of ENSDARG00000070157 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 43634805)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43374543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCTACAATGGCACACTTGGAGAGACCTGCGGACTGGGAGAGTTTACG[G/T]AGATTAGCTTAGCTTCTTCTGAAGGTAAGACATGTTTAACTAGTAGTTTC
Associated Phenotype:
Not determined