Busch Lab

ZMP

aste1

Ensembl ID:
ENSDARG00000070132
ZFIN ID:
ZDB-GENE-060503-520
Description:
Protein asteroid homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LYL8]
Human Orthologue:
ASTE1
Human Description:
asteroid homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:25021]
Mouse Orthologue:
Aste1
Mouse Description:
asteroid homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913845]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1864 Nonsense F2 line generated Not yet available
sa18428 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28726
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102665 Nonsense 47 692 2 5
ENSDART00000121448 Nonsense 47 692 1 4
Genomic Location (Zv9):
Chromosome 16 (position 44341253)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41621761
GRCz11 16 41571793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATGGATGCAATTTATTTTACTCACTGTGTTTTGACTCCAATCTGGAT[C/T]AGATTCACGGAGGAGACTATGATACCTTTGAGAAAGTGGTCAGACAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1864
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102665 Nonsense 143 692 2 5
ENSDART00000121448 Nonsense 143 692 1 4
Genomic Location (Zv9):
Chromosome 16 (position 44341543)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41622051
GRCz11 16 41572083
KASP Assay ID:
554-1855.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAAGAAGCTCAAGGTACCGGTGGTGCAGACTCTYGAAGAGGCCGATTG[G/A]GAAATTGCAGCGTTGGCAGAAGAATGGAATTGTCCAGTTTTGTCCAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18428
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102665 Nonsense 527 692 4 5
ENSDART00000121448 Nonsense 527 692 3 4
Genomic Location (Zv9):
Chromosome 16 (position 44345529)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41626037
GRCz11 16 41576069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAGCCGAAAAGGAGGCTCTGTGGATATTGATGTCGCTCATGCTTACAGC[C/T]AGTGGCAGTCCTGTCTGAAGKACAGCCTCAATCTCAACTATCTGCTGTCT
Associated Phenotype:
Not determined