Busch Lab

ZMP

zgc:136346

Ensembl ID:
ENSDARG00000070108
ZFIN ID:
ZDB-GENE-060512-191
Description:
protein DEK [Source:RefSeq peptide;Acc:NP_001038741]
Human Orthologue:
DEK
Human Description:
DEK oncogene [Source:HGNC Symbol;Acc:2768]
Mouse Orthologue:
Dek
Mouse Description:
DEK oncogene (DNA binding) Gene [Source:MGI Symbol;Acc:MGI:1926209]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22921 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4679
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058586 Nonsense 99 443 3 11
ENSDART00000102594 Nonsense 99 389 3 12
ENSDART00000124543 Nonsense 99 104 3 3
Genomic Location (Zv9):
Chromosome 16 (position 43687390)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41071783
GRCz11 16 41021815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGGGAAGCTTAAAGCTCCTTTGCTCAAACCGCTGCATAAGATCCTATA[T/A]GATCGACCAGGGGCTGTAAGGCGTTGTTTTGAGATCTTCCTTAACAAATA
Long Flanking Sequence:
TGGAAGTAAAATGTTAAGTGATGGAAGACTTTCATTGTATATGCTGGGGGTTTGAATTACAAAGGTACTCGCTTTAAAATTATTAGTGATTTTAAAAGTCCTTGAATTTGGTGTCCATGAAAAAATGGGAACCCTGAGTTTTGCTGTCAATATAAAATAATTCCACATCAGACATTTTCTTTACACGCATAGCATACAATCAAGGCATATTCTGTTCTGCTTTATTGACAGGATAAAAACACACTTTTCTTTAATAATCTGGCAGACTCATCATCGCCATTGCAATGTTTTCTAATTGTCTTTTCAGTTGAACTGGAAATCGTTGAAGGAAAACGTGAGAAAAAGGTCATCCAGAGACTTGATATGATGAGTAAACCAAAGGAAAAGCCGAAGATTGAGAGCAAAGGAAGAGGCGACAAGCTGGGAGACATTGCACGAATTAACCACTCCATTGGGAAGCTTAAAGCTCCTTTGCTCAAACCGCTGCATAAGATCCTATA[T/A]GATCGACCAGGGGCTGTAAGGCGTTGTTTTGAGATCTTCCTTAACAAATAAGTGGCCAAAATCTATAGCTAATGATGATTCATGTTTACGCAGGCATCAACACTGCGGAAAAATCTGCGGCTCTTTAATGGATTTCCCTTTAAAGAGGACAGTGACCTTTACAACAAAAAGATGGAGAAGGTGAAAAGGTATTTAACTGGTTTGATAATGCTTTATATGTAAATACATTCACATGCCTATGAAAACCGAATTAGTTTATGCTCTATTAGGTATTGTTTTTTATTTTTTATTTATTTATTTATGCACATTTTGGCTTAAAACTGAATGAAATTGGCAAATTGCATATGAAATCTTTAAATACATCTAATAAGCAAGATTTCCATGGGCCCTTAAGGTCAAAGAAAATAATTCAATACAGGTCCTTTAAAGTGTTTTTTTTTTATCTTTCTTAAATCCATGTTATTCCCCCGGTCCACTAATGTGTTTGCATGTTGTGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22921
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058586 Nonsense 416 443 9 11
ENSDART00000102594 None None 389 10 12
ENSDART00000124543 None None 104 None 3
Genomic Location (Zv9):
Chromosome 16 (position 43694187)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41078580
GRCz11 16 41028612
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTCCTGAAAGACGCAAACCTGGAGGAGGTTACAATGAAGCAGATAACC[C/T]GACAAGTATGTTATTTCACCTTTATTGGGACAGAAGCTTACTTTAAAGGG
Long Flanking Sequence:
TGTTACAGTTTTGAAAGAATTCAAAACTATTACATTTATGGCACTGTAAGAAACGAGTACAACTTTATAACTGCAGCCACAGATCCGACAATACAAAAATCCTTTCAGCAGAAATTGCATTTAAACTAACAATTTTCATCTCAATATTCCTAGACAAAAAAGAAGCCTGCAGCAAAGAGAAAAGCTCCAGCAAAGCCTGTCCCGAAAACTAAGAAAGCAGACAGCAGCAGCAACCGAAAGAAAAAGACTGCAAGCAAGAGAAAAGGTATTAATGCGGTCATATTATAAATGTTTAATAGAAATGGTAAATATTGTGTTTTGCAGTGTGTAGAGATTAATATGCTGTAGTTCTGCTTCTAGATGAAAGCGAAAGCTCTGATGACGATCAACCTTTGATCAAAATGATCAAAAAACCACCAACAGATGAGCAGTTGAAGGAGAACGTAAAAGACCTCCTGAAAGACGCAAACCTGGAGGAGGTTACAATGAAGCAGATAACC[C/T]GACAAGTATGTTATTTCACCTTTATTGGGACAGAAGCTTACTTTAAAGGGTTATGATCTGTATTGCAGTTTAACTAACTAGACCAGGGGTTCCCAAACTTTTCAGCCCACGACCCCTAAAATAACAATTCCAGTGGCTTGCAACCCCCAGTATTCTCTGAGGTGGTTTTACATATATAAAACCAGCACACAATGGTGCACACAACCAATATGCCCAAGTCTATTCGTCGTTTAATTTTGGAGAGCGCCACCCCAAGACCATCCTCCATGTTAAGTTGTGTCATTTATTTATTTTTATAATGTACGTGATTGCACGTGAAATCAATGTGTTGCATCTGACGCTATTCCTATGTCTATAATATAACAATAATCACCACAAGGATTACAAAAAATATTGAAAGGCTTATGGCTTTTTATTTTCATGTTGTTTTTAATGGTTATTATTACCATGCTAACAATGGTACTATAAACTACTATTTTGTTCTTCAGCTAGTTATGGAT
Associated Phenotype:
Not determined