Busch Lab

ZMP

zgc:163069

Ensembl ID:
ENSDARG00000070083
ZFIN ID:
ZDB-GENE-070424-51
Description:
ATP synthase subunit beta [Source:UniProtKB/TrEMBL;Acc:Q05AL6]
Human Orthologue:
ATP5B
Human Description:
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide [Source:HGNC Symbol;Acc:83
Mouse Orthologue:
Atp5b
Mouse Description:
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35047 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21867 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27747
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060310 Nonsense 37 529 1 11
Genomic Location (Zv9):
Chromosome 11 (position 13393493)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13150316
GRCz11 11 13207975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTATATATAAGCTCCTCAGCCTCTACCCGATTCCACCTTCAGCCATTT[T/A]AACAATGTTGGGAGCTGTGGGACGCTGCTGCACTGGGGCTTTGCAGGCTC
Long Flanking Sequence:
GGCCTGTTGTTATTGCAATAAAACAACAACAACAGCACAAAAACAATTGAGATCAGAGCTAAGAAACTGTGAGACGTTTAGCGTTACTGTTTCTTTGTTAACGTTATATCTTATCTGCTCAAAAGCATTTAATATTTTCTAACATACTGATAATGAGCACGCACACAAACTGTTAGGGTACATCCTAAATTCTATTGCATCTAAAAATAAGCGCCTCTGGACTGTAGTAATAACGGCAATAATAGAAATAACGTTATAATATTTATATATGTGTAGCTATACAGATATAAATATATATGGCTATAGTTGTTCACTTGCATAGACTTCCCTTGCAGATTTAAAATGCTATTCATGATGCCCAGACTGTCCTTCAACTCCACCGCATGCGCAGATGCTAAGTTCCCGTGTCGCCATTGTCTTCCACGCATGCGCAGTGCGAGGTTCAAGCGGCACTATATATAAGCTCCTCAGCCTCTACCCGATTCCACCTTCAGCCATTT[T/A]AACAATGTTGGGAGCTGTGGGACGCTGCTGCACTGGGGCTTTGCAGGCTCTCAAGCCCGGGGTTCACCCCCTGAAGGCTCTCAACGGAGCTCCATCTCTGTTTTCACGTAAGTGAAATACATTTTGTTTTGAAAGTTGTTTTAGCGCAGCTTTTCTGACAGCAACGTCACCGCCGGCGCGAGACCGCTAAATGGCAGCATGCGGACTCTAAGTGCAGGCCGCAAAGTTTAACGTCAATATTTTTAGTGATTGGTTTCGTCTGATGCACTACTTTGACTTTGAATTGTGCTGGAAATGTGTTGTCATACCACAGTACTCTATTTTAATGACAACAGCTAGTTGTTGTTGGTAAGAAATCGGGAATGACCTTTATGTGTCATGGAGAGGAGGCTCGCGTTGCTAGCTGTTTCCCAGCCTGCGAGGTCATGGTACAGAAGACATGTGGAATAAGATCACGGGATAATGCAAACGCATTTATAAACATTCATGAACAGTTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35047
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060310 Essential Splice Site 318 529 7 11
Genomic Location (Zv9):
Chromosome 11 (position 13396513)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13153336
GRCz11 11 13210995
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCTTTATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGG[T/C]CAGTAAACGATTCATAAGTCAAATATAAAAAAGTAAATCAATAAATAAAA
Long Flanking Sequence:
CAAATCGTGCCATGCTTAAGCTAACTTAAAGCACCATCTCGTTTTCAGGTCTTTTCGGTGGTGCTGGTGTGGGAAAGACTGTGTTGATTATGGAGCTGATCAACAACGTGGCTAAGGCTCATGGTGGTTACTCCGTGTTTGCTGGTGTGGGAGAGAGGACCCGTGAGGGAAACGATCTCTACCATGAAATGATTGAGTCTGGTGTCATCAACCTGAAGGACACCACCTCAAAGGTGACTTAAAGATCTTCTCAGATCCACTCGTAGAGAAGTAAAGCTAAAAGGTTTATGCTTGTAAACTTTAGAACTGCATTAAATTACAAGGTCCTCTTGATTGTTAGGTGGCACTGGTGTACGGACAGATGAACGAGCCCCCAGGTGCCCGTGCCCGTGTGGCTTTGACAGGACTGACCGTTGCTGAGTATTTCCGTGATCAGGAGGGACAGGATGTGCTGCTCTTTATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGG[T/C]CAGTAAACGATTCATAAGTCAAATATAAAAAAGTAAATCAATAAATAAAATCTGGTTTAAGGGTTATGTTGATTTGATTTCTTTTTTGATTAGGTGTCTGCCCTTCTGGGTCGTATCCCCTCTGCTGTGGGTTATCAGCCAACTCTGGCCACTGACATGGGTACCATGCAGGAAAGAATCACAACCACCAAGAAGGGTTCAATCACATCTGTGCAGGTATGCTTCCTGTTGTTATTACAAGACACCTGCTGTGTTCATGTTGGTAAAGATGATAATTGACCAAATTTCACCATAGAATCACACTTGAGTTATTTTTGGAAGCATTTAGTTTTTTAGAAGCTCCATTTTAAGTTCAAGTTCCCAGGCCAAAAAAAAAAAAAAGTTCTGCATTTTGTGAGTTCTAGACCTTTTTGTTTACACTTTGCACCTACAAAATATGTAGTACAGTTGCATTAGAATGTAACCGTGTAATCTACAGCATATTCATAAATGAGAACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21867
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060310 Nonsense 332 529 8 11
Genomic Location (Zv9):
Chromosome 11 (position 13396648)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13153471
GRCz11 11 13211130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGATTAGGTGTCTGCCCTTCTGGGTCGTATCCCCTCTGCTGTGGGTTA[T/A]CAGCCAACTCTGGCCACTGACATGGGTACCATGCAGGAAAGAATCACAAC
Long Flanking Sequence:
TGTTTGCTGGTGTGGGAGAGAGGACCCGTGAGGGAAACGATCTCTACCATGAAATGATTGAGTCTGGTGTCATCAACCTGAAGGACACCACCTCAAAGGTGACTTAAAGATCTTCTCAGATCCACTCGTAGAGAAGTAAAGCTAAAAGGTTTATGCTTGTAAACTTTAGAACTGCATTAAATTACAAGGTCCTCTTGATTGTTAGGTGGCACTGGTGTACGGACAGATGAACGAGCCCCCAGGTGCCCGTGCCCGTGTGGCTTTGACAGGACTGACCGTTGCTGAGTATTTCCGTGATCAGGAGGGACAGGATGTGCTGCTCTTTATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTCAGTAAACGATTCATAAGTCAAATATAAAAAAGTAAATCAATAAATAAAATCTGGTTTAAGGGTTATGTTGATTTGATTTCTTTTTTGATTAGGTGTCTGCCCTTCTGGGTCGTATCCCCTCTGCTGTGGGTTA[T/A]CAGCCAACTCTGGCCACTGACATGGGTACCATGCAGGAAAGAATCACAACCACCAAGAAGGGTTCAATCACATCTGTGCAGGTATGCTTCCTGTTGTTATTACAAGACACCTGCTGTGTTCATGTTGGTAAAGATGATAATTGACCAAATTTCACCATAGAATCACACTTGAGTTATTTTTGGAAGCATTTAGTTTTTTAGAAGCTCCATTTTAAGTTCAAGTTCCCAGGCCAAAAAAAAAAAAAAGTTCTGCATTTTGTGAGTTCTAGACCTTTTTGTTTACACTTTGCACCTACAAAATATGTAGTACAGTTGCATTAGAATGTAACCGTGTAATCTACAGCATATTCATAAATGAGAACTTGATAACAAAGGGGAAAAGGTAGTGGTTTTGTACACTTGAATATTATTTTTATAATTTAATAACTCCCAAGTAAACAATTTCCTTTGAGCACTTGCAGGGGCAGATTTAATGATTTTGGGGCCCCCAAGCAATTCCA
Associated Phenotype:
Not determined