Busch Lab

ZMP

zgc:162040

Ensembl ID:
ENSDARG00000070081
ZFIN ID:
ZDB-GENE-030131-9814
Description:
R-spondin-3 [Source:UniProtKB/Swiss-Prot;Acc:Q5R328]
Human Orthologue:
RSPO3
Human Description:
R-spondin 3 homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:20866]
Mouse Orthologue:
Rspo3
Mouse Description:
R-spondin 3 homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1920030]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa14295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14295
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058578 Nonsense 297 317 6 6

The following transcripts of ENSDARG00000070081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 43004839)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40388289
GRCz11 16 40338321
KASP Assay ID:
2261-0147.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAGAGGAAGAGGGAACGAGAGAAGGAGACAATCGACCGAGAGGAATCC[G/T]AAARCAGGAAYAAAACAGARCAGCGCCGYCGCAGGGACCAGAGCAGAGAC
Associated Phenotype:
Not determined