Busch Lab

ZMP

ABCB11

Ensembl ID:
ENSDARG00000070078
Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 [Source:HGNC Symbol;Acc:42]
Human Orthologue:
ABCB11
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 [Source:HGNC Symbol;Acc:42]
Mouse Orthologue:
Abcb11
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 Gene [Source:MGI Symbol;Acc:MGI:1351619]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6199 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6200 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6199
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL4-111
KASP Assay Location:
Project 554.35, Plate 19, Well C03
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102557 Essential Splice Site 969 1352 22 28
Genomic Location (Zv9):
Chromosome 11 (position 13440918)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13197741
GRCz11 11 13255400
KASP Assay ID:
554-5479.1 (used for ordering genotyping assays)
KASP Sequence:
TTACTGGATTCGCCAAGCAGGACAAAGAGGCCATGGAGACAGCAGGGCAG[G/A]TGAGCTCATGCTACACTGCAGTAGTGGAGATCAAAATTAGAACAATTTAT
Long Flanking Sequence:
ATTGTTGGGTATTTGTATTTATTTCCAGGGCTATGCATTCTCTAAATCCGGCGAGCTGCTCACTCGTAGATTGAGGCGTCTGGGCTTTCAGGCAATGTTGGGGCAGGAGATCGGCTGGTTTGATGATCGCAAAAACAGCCCTGGTGCTTTAACAACACGACTGGCTACAGATGCCTCGCAAGTCCAGGGAGTAAGAAAATCACTTAGCTGAAATGTTTCCATTAGCTCCCACATGTTATGTGACCCTTTTCAATCAAAATAAAACTTTATTAAGACTAAATAAACTCTCACCCCAGGCCACAGGTTCTCAGATCGGCATGATTGTGAATTCTCTGACCAACATCGGTGTGGCTGTTATCATCTCCTTTTACTTCAGCTGGAAGCTCACTCTGGTCATCCTGTGCTTCCTTCCATTCTTGGCTCTTTCTGGAGGGTTTCAGGCTAAAATGCTTACTGGATTCGCCAAGCAGGACAAAGAGGCCATGGAGACAGCAGGGCAG[G/A]TGAGCTCATGCTACACTGCAGTAGTGGAGATCAAAATTAGAACAATTTATAAACACTCGATATCTTTCATAAACAATCATAATTAATAATAATCCAAATTTAGACCTTTCCCAGAAAGCATTTTGTGTTTTTAAAAAATGTCTAATACATGTCTAATAGGCGTCTAAACATAGTCGTCTTGGCTAAAACAGAGCTAAATTTACACTGTCAGTTAAAATCTAATACACGTCTAAAAATAGGTCAACACTAGACTAGTCATCAAATAAACAGAAATGATTGACTACACATATAAAGTCACTTTAATCAGTCGATTTGACGACTAGTCTAGTTCCGGGCTATTCTTAGATGTCTATTAGATTTTCACTCACAGGCCAATCTTAGCCTTGTTTTAGAAAAGCTCTCTGCATTTAGATGTCTATTAGACGTCTATTATCACAAAATTGTTTGCTGGGATAGATTTCCTGCATCCCAATAAAGACTATTACTCAGTTGTAGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6200
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL4-49
KASP Assay Location:
Project 554.35, Plate 7, Well H07
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102557 Essential Splice Site 1286 1352 27 28
Genomic Location (Zv9):
Chromosome 11 (position 13453822)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13210645
GRCz11 11 13268304
KASP Assay ID:
554-4611.1 (used for ordering genotyping assays)
KASP Sequence:
TACTGCTTCTRGATGAGGCCACCTCAGCACTAGACACAGAAAGYGAGAAG[G/A]TGAGCAGGAAAGCYAGCAAAACGAGTTTTAGAAGATGTTTAAGAGGTCAT
Long Flanking Sequence:
TTGTGATATAAAGTCCCCTGTTTTTATATTTGAAATGATTTCAAATGTGTATTAAACTATAACTATATCTTTATTGTTATCTAGTTACCATGCAGGATGTGAACAGGCCTTACATTAGTAGTAGTTTAAATAAAATAAAAAAAGTAGTTTAAATTCTGAAGCAGTTTTAGTTTTAAAGTGGTTTTAAGTGGCTTTTGCTAGGCAGTTGTTGGATGGATGCTACATGCAAGTAGATACTATACTACTGTTTTGATTGGTTGCTAGGGTCTTTCTGGGTGGTCACTGGGATGTTTTTGGCATGGTCTTATGTAGAAAAGAAGATCTCATTAATACATCTTCCTCCCATGATGCAGAAATACGACACCAATGTTGGTTCCCAAGGTTCCCAGCTTTCCCGGGGTCAAAAACAGCGTATTGCCATAGCCAGAGCGATCATAAGAGACCCCAAAATACTGCTTCTGGATGAGGCCACCTCAGCACTAGACACAGAAAGTGAGAAG[G/A]TGAGCAGGAAAGCTAGCAAAACGAGTTTTAGAAGATGTTTAAGAGGTCATTTAGGAACTCGTAGTCTATGTTTGTTTGTGTTTCAGACTGTACAGGAGGCCTTGGATAAAGCCAGAGAAGGCAGAACATGTATTGTCATCGCTCACCGTCTGTCTACTATCCAGAACTCTGACATCATAGCTGTGATGTCAAGAGGATACGTCATTGAGAAGGGCACGCATGACTATCTGATGGGCCTGAAGGGGGCGTACTATAAACTTGTCACGACTGGAGCTCCAATCAGTTAATCTTACTCTCAACGAGGCAGATAGAAAGACCAATCAGCACTGTAGACCTGGTGTGGACATGGATGTGCATTATTTTCTTATGTTTTTAAAGACCAAGGTCTATTATTCTGCCTATGATAGTCAGCGAAACTAAAGATATCCGTTAGATGTTGCATTTCAAGCTTGTTTTCAGATTTTTATCTTCAAAGATGTATGGGAGGTGGGTGTGATTTT
Associated Phenotype:
Not determined