Busch Lab

ZMP

si:dkey-108d22.5

Ensembl ID:
ENSDARG00000070015
ZFIN ID:
ZDB-GENE-041210-89
Description:
Novel protein similar to pim oncogene family [Source:UniProtKB/TrEMBL;Acc:Q1LX85]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16211 Nonsense Available for shipment Available now
sa33408 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7318 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16211
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067272 Nonsense 6 288 1 6
ENSDART00000136981 None None 123 None 4
ENSDART00000140018 Nonsense 12 281 1 5
Genomic Location (Zv9):
Chromosome 4 (position 10468350)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11404977
GRCz11 4 11403826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTTTATTTTTTAACAGACATCATTTTAAGGCATTACAAAATTGGTGAC[A/T]AGCTGGGCAAAGGTGGATTCGGCTCTGTCTACAAAGSCACACGCCGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33408
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067272 Essential Splice Site 169 288 3 6
ENSDART00000136981 None None 123 None 4
ENSDART00000140018 Essential Splice Site 175 281 3 5
Genomic Location (Zv9):
Chromosome 4 (position 10467245)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11403872
GRCz11 4 11402721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCGGCTGTGGTGCGATCGCAAAGGAATCAGGCTACAAAGTCTTCTGTG[G/C]TAAGTGTTATGAACTTTGTTGTCATAAAAATAACATACTAAAGATTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7318
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067272 Nonsense 233 288 5 6
ENSDART00000136981 Nonsense 94 123 3 4
ENSDART00000140018 None None 281 None 5
Genomic Location (Zv9):
Chromosome 4 (position 10466618)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11403245
GRCz11 4 11402094
KASP Assay ID:
554-4935.1 (used for ordering genotyping assays)
KASP Sequence:
TAAACTATYACCCTTAAACACCCCATTCTTCTTTCTGCACAGAATGCTGC[C/T]RGATGATCTGCGGTTGTCTGCAGCCAGACCCAGATGAGAGACTCGCTCTG
Associated Phenotype:
Not determined