Busch Lab

ZMP

si:ch211-167j6.4

Ensembl ID:
ENSDARG00000070011
ZFIN ID:
ZDB-GENE-070912-146
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6109 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21445 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5527
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102386 Essential Splice Site 106 276 None 8
ENSDART00000146477 Essential Splice Site 47 213 None 5
Genomic Location (Zv9):
Chromosome 9 (position 13166533)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12919098
GRCz11 9 12890301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTGGATGGAAATGTCTACATTGCMTACTCACTCTCTCATGCGTACGG[T/A]AAGCAGAAAACCATACACCTTTTATTATCACATACAGTGCCGCAGTAAAC
Long Flanking Sequence:
ATTTCCAGACTGTTTAAATATTTATTTTATTCACATAAAATGGACAGAGCATTCAGTGAAAGTAAAAAAGAAAAAAAATGGACTACTTTAGACTTTCCGTTGACTATAAATATTGGAAACTTTTTAAAGTAACAGTTACAACTTACTCAAGCCCCCTAACCTTAATCTAACAGTGTATGACTAATCACTTGTAGACGCCAAGTTGCGTTTTCAGTTAACAGATAAAGTGTTTTAAACATCCACAGCAATTTAATCTTCTCTAAATAACCTTTTGTGAATTGAAAAGGACTGCAAAAAGTAATTAATGAAAGAATCAATGCCAAAAAAAAGTCTTATTCTCTGTCTCTAGGTGTCTTTTCTGTGGACGGCACCAATCTCAGAGAAGGAGATATTGCTGTGTCTGGAAGGAGTCAGAAGAACTGTTTTGCCAGGAGCTGCCTGTGGACCAAATCTGTGGATGGAAATGTCTACATTGCCTACTCACTCTCTCATGCGTACGG[T/A]AAGCAGAAAACCATACACCTTTTATTATCACATACAGTGCCGCAGTAAACACTAACTTGGTTTTGGTTTGACAGACGATGCAGACGTGAAGAACATTAAGGAAGGCATGGAGCTCATCGAACAGGACACTTGTGTGCGCTTCGTGCCCAGAACTCACCAGAGGGACTATCTGGATATTCAGCCCAAAACAGGGTACATTGTAGAAGTATTCTGCAAAAGTATTAACAAAAAAACTCACTGCTGTGGCTGTTAGAAGTTTACAGCTTAAAAATACAGTCAAAAGACGTTTCTAAATGTACAGTGAACTAACATTTTCCATCAACTTATACAATGTGAATACAGCAATGTTGTGAGGTATTAACATCTACATTGTACCTATGAGATGAAACAAATACAAACATGATAAAGATTATAACTAATAACTTTTCCACAAGCAGAGAAGATATAGAATTAATATGTAAAGGTGCTCATTTACTCAACTACTACATACCAACATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6109
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102386 Essential Splice Site 232 276 7 8
ENSDART00000146477 Essential Splice Site 173 213 4 5
Genomic Location (Zv9):
Chromosome 9 (position 13169839)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12922404
GRCz11 9 12893607
KASP Assay ID:
554-3787.1 (used for ordering genotyping assays)
KASP Sequence:
AACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAA[G/A]TAAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTNAAAAGTGC
Long Flanking Sequence:
TTTACTATTAACCGATTATTACAGTAGTGCTTTTTATATATTTTCCGTCTTATTAAAATCACAGCCGTTTTTTTTAAAGAGTATAAACATCTTTAATATTAACATTGGCTTCACCCTGAGTGGATCTCATTGTTTCTTATCAAGGTGTTGGTCATATTTGGGGGCACGTGGTGGTAGACAAACCATTTCTCTACAATCGCCCGACTGCACCGGGTCTGGGGTCACTGTGCATGAGCTGATGCATGCTTTGGGCTTTGTGCATGAACAATCCAGAGCCGACCGGGACAAGTATGTGACCATCATGTGGTCTAATATATGGAAAGGTACAGTAATGTCCTTATATTTTTAGATGTAAAGTCAATATGAAGTTGTTTAATCGATTACTCACACTTCTGTTCATATATTTAAATATTTATAGACAGGCTGAGGAATTTCGAAAAGTTTAAAACAAACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAA[G/A]TAAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTAAAAAGTGCAATTATCATAGAATTATTGTTTATTTCAGGTATGCCTTTTCTGAGGATGGAGAACCAACTATTGTGCCGAAAAGGAACTGGAATGTGAAGATTGGACAGAGATTGGGACCCAGCGACTTGGATATAATGAAGATTAATAAACTGTACAGCTGTAATATGCAGTAAAGTCCATACACAGCAACGAATGATCCATCAGAAGGATTTTATCTGAGATTAATGCTTATTTTAACACTTTGCTTGACATTAAATAGTTAATTTTGAGATTGCTAATATAATAATAATTATTAATCATTTTATTTTGTAACCAGCTGTTTCAGTTTATATATCCTTTCATGTTCAGATATTCTGACATCATGTCTCAAATAAACACATTACACCAATAAAACGTTTCCATACTATTATTTTTCATTCATTCATGTCACTGTGAAATGTTTTAAACATCCAAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102386 Essential Splice Site 232 276 7 8
ENSDART00000146477 Essential Splice Site 173 213 4 5
Genomic Location (Zv9):
Chromosome 9 (position 13169840)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12922405
GRCz11 9 12893608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAAG[T/C]AAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTAAAAAGTGCA
Long Flanking Sequence:
TTACTATTAACCGATTATTACAGTAGTGCTTTTTATATATTTTCCGTCTTATTAAAATCACAGCCGTTTTTTTTAAAGAGTATAAACATCTTTAATATTAACATTGGCTTCACCCTGAGTGGATCTCATTGTTTCTTATCAAGGTGTTGGTCATATTTGGGGGCACGTGGTGGTAGACAAACCATTTCTCTACAATCGCCCGACTGCACCGGGTCTGGGGTCACTGTGCATGAGCTGATGCATGCTTTGGGCTTTGTGCATGAACAATCCAGAGCCGACCGGGACAAGTATGTGACCATCATGTGGTCTAATATATGGAAAGGTACAGTAATGTCCTTATATTTTTAGATGTAAAGTCAATATGAAGTTGTTTAATCGATTACTCACACTTCTGTTCATATATTTAAATATTTATAGACAGGCTGAGGAATTTCGAAAAGTTTAAAACAAACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAAG[T/C]AAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTAAAAAGTGCAATTATCATAGAATTATTGTTTATTTCAGGTATGCCTTTTCTGAGGATGGAGAACCAACTATTGTGCCGAAAAGGAACTGGAATGTGAAGATTGGACAGAGATTGGGACCCAGCGACTTGGATATAATGAAGATTAATAAACTGTACAGCTGTAATATGCAGTAAAGTCCATACACAGCAACGAATGATCCATCAGAAGGATTTTATCTGAGATTAATGCTTATTTTAACACTTTGCTTGACATTAAATAGTTAATTTTGAGATTGCTAATATAATAATAATTATTAATCATTTTATTTTGTAACCAGCTGTTTCAGTTTATATATCCTTTCATGTTCAGATATTCTGACATCATGTCTCAAATAAACACATTACACCAATAAAACGTTTCCATACTATTATTTTTCATTCATTCATGTCACTGTGAAATGTTTTAAACATCCAAATGAGA
Associated Phenotype:
Not determined