Busch Lab

ZMP

elna

Ensembl ID:
ENSDARG00000069994
ZFIN ID:
ZDB-GENE-061212-1
Description:
elastin a [Source:RefSeq peptide;Acc:NP_001073532]
Human Orthologue:
ELN
Human Description:
elastin [Source:HGNC Symbol;Acc:3327]
Mouse Orthologue:
Eln
Mouse Description:
elastin Gene [Source:MGI Symbol;Acc:MGI:95317]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa12235 Nonsense Available for shipment Available now
sa17177 Nonsense Available for shipment Available now
sa42459 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42460 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11039 Essential Splice Site Available for shipment Available now
sa42461 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32006 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12235
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 3 1079 1 52
Genomic Location (Zv9):
Chromosome 15 (position 163469)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 386803
GRCz11 15 296244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGANTTTTCTTTGAATCTGTTGCTACATATCTCTCTGGCTGTAGGTGGATA[T/A]GGGGGTTATGGTGGATATGGTGGTGCTGGAAGATTCTACCCAATGGCTGG
Long Flanking Sequence:
CTAATTAAATGATCTGTTGTTCAAGATTATCAGCAAGATTATTAATTGTATTAGACAAAAATCTCATATCTGTGTGTCAGAATATCAGGATTCTTGAATCTTTAAATCTACAGTGCTCTTAGATTTCTATTGGCAACAAGGCAAAAGAAAGATTGACAAGCAAAGCATTTACTGCACATCCTTTCCATTCCTGTGTTCCTCCCTCCGCTATAAAATAGGAATGCAAGCTTTGCAACCTCATTTGTTTAGCGTTTCCATGTCGAAGGAGGACGCGATGTAGCAATAATTCTCAATGGAGCCTAACTCCTCATTTGCTCAGCCAAAAAGATTCACCGTTAGCCTCGTTCTCTTTCAACTTTCTTTTCTTTTGTTTTCTCATTCCTTCCCTCCCTGTCCTGTTGCTAAATCAGCCCTTAGCATTGACAGTCTAAGTCATTCGAGGGCGGAGGTAGATTTTCTTTGAATCTGTTGCTACATATCTCTCTGGCTGTAGGTGGATA[T/A]GGGGGTTATGGTGGATATGGTGGTGCTGGAAGATTCTACCCAATGGCTGGAGGTCTGAAACCAGCTAAATCAGGTGCTCATTCCATGAACAGTCAGCAAAGTTTATATGGAAAATAGTAATTGAGCATTAATATGAGCATTCATGTTTCCCTCTAGGAGCTGGGCTACCAGGAGGAGTTCTGCCAGGAGGAGTTCTGCCTGGAGGAGTTCTGCCTGGAGGAGTTCTGCCTGGAGGAGTTCTGCCTGGAGGTGGTCTTCCTGGAGGTGCCATTCTGCTGACATTTTCGGTTTTCTTAGTGTCTAAGTAACAAAAGCTGCACAAATGTTTTCTAAATCGGATTCTCTTGTTTCAGGTGCTGGTGGAAAGCCCCCCAAAGGTGGTAATATATGTCCATTGTCTCCAACTCTTTCTAAATGAAACATAGTTCAGAGAAAAACATTTAGAGGGGAATTGGATAGGAAGAAGTTGATCTCTGTTTATTCATGAAGTAAAAACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17177
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 13 1079 1 52
Genomic Location (Zv9):
Chromosome 15 (position 163497)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 386775
GRCz11 15 296216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTCTGGCTGTAGGTGGATAWGGGGGTTATGGTGGATATGGTGGTGCT[G/T]GAAGATTCTACCCAATGGCTGGAGGTCTGAAACCAGCTAAATCAGGTGCT
Long Flanking Sequence:
ATCAGCAAGATTATTAATTGTATTAGACAAAAATCTCATATCTGTGTGTCAGAATATCAGGATTCTTGAATCTTTAAATCTACAGTGCTCTTAGATTTCTATTGGCAACAAGGCAAAAGAAAGATTGACAAGCAAAGCATTTACTGCACATCCTTTCCATTCCTGTGTTCCTCCCTCCGCTATAAAATAGGAATGCAAGCTTTGCAACCTCATTTGTTTAGCGTTTCCATGTCGAAGGAGGACGCGATGTAGCAATAATTCTCAATGGAGCCTAACTCCTCATTTGCTCAGCCAAAAAGATTCACCGTTAGCCTCGTTCTCTTTCAACTTTCTTTTCTTTTGTTTTCTCATTCCTTCCCTCCCTGTCCTGTTGCTAAATCAGCCCTTAGCATTGACAGTCTAAGTCATTCGAGGGCGGAGGTAGATTTTCTTTGAATCTGTTGCTACATATCTCTCTGGCTGTAGGTGGATATGGGGGTTATGGTGGATATGGTGGTGCT[G/T]GAAGATTCTACCCAATGGCTGGAGGTCTGAAACCAGCTAAATCAGGTGCTCATTCCATGAACAGTCAGCAAAGTTTATATGGAAAATAGTAATTGAGCATTAATATGAGCATTCATGTTTCCCTCTAGGAGCTGGGCTACCAGGAGGAGTTCTGCCAGGAGGAGTTCTGCCTGGAGGAGTTCTGCCTGGAGGAGTTCTGCCTGGAGGAGTTCTGCCTGGAGGTGGTCTTCCTGGAGGTGCCATTCTGCTGACATTTTCGGTTTTCTTAGTGTCTAAGTAACAAAAGCTGCACAAATGTTTTCTAAATCGGATTCTCTTGTTTCAGGTGCTGGTGGAAAGCCCCCCAAAGGTGGTAATATATGTCCATTGTCTCCAACTCTTTCTAAATGAAACATAGTTCAGAGAAAAACATTTAGAGGGGAATTGGATAGGAAGAAGTTGATCTCTGTTTATTCATGAAGTAAAAACACACATGTTCGTTTTTAACACCTTTTACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42459
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 558 1079 24 52
Genomic Location (Zv9):
Chromosome 15 (position 173902)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 376370
GRCz11 15 285811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGTGCTGGTGCACTCTCCCCTGCTCAGGCAAAAGCTGCTAAATATGG[T/A]AAGCATGCATATTAACTGATGTACCAGTGTTAATTAATTATGACCAAAGT
Long Flanking Sequence:
AACCATAATCAAACACACCTGTTGAAAGCTTTCTAATGATCTTGAAGACATTGATTAGCATCTTCGAGTGTGTTTGATTAGTGTTTGAACAAAACTCTGCAGCACAGCAGTCTTCAAGGACCAAGTTTGCCCATCCCTGGTTTAAAGAGATATTTGGAACATCATGAGATCAAGTCTTAGTATTGTTGTACATTTTCAATCTTTGAGGTTTACTTCAGAGTCTATATTTGTATTGGTCCTGGAACATCTGTTCTATCGAGACAGCATTGTTCTAACCCTTCTGCAACCTCAATTCTAACCTCACCATCTCACTGTCTGACATAAATAATTTACCAGGAGCAAAGTTGTCTTGCAAAAAATATGTTCCCCTTTTGTGATGCTTTAGACTTGACTGTCAGTTTATTAGAATGATCTAATAGTCATCTTTTTTGTTGTTGTTTACCTGTGTGTGAAGGTGCTGGTGCACTCTCCCCTGCTCAGGCAAAAGCTGCTAAATATGG[T/A]AAGCATGCATATTAACTGATGTACCAGTGTTAATTAATTATGACCAAAGTCAAACTCATTCAAAGAAGTCAATCAGTGTCTTTAGAATAAGTAGAAATGAACAGGCTGAAGTTTAACATTAGATCTAGACTCTGTAGAACAGAGATGCTCAACCTGTTCCTGGAGATCCACCTTCCCGCAGAGTTCAGCTCCAACCACAATTAAACCCAACTAAACCAACTGAGACGAATCCGAAGGAACACTTGGTAATTAAAGACAGGTGCGTTTGATCAAGGTGGTAGCTAAACTGTTGAGGAAGGTAGATCTCCAAGAACAGGTTTGGACACCCCTGCTGTAAAGTAGCAGTCTTCTTCCAGCACTGAAGACACCTGAAATATTAAATTGGGAATTTCACATTGAGTGTTCATTGCCCTGCCTTGATCCAGGAGCAGTTCCTGGTGGTGCCGGGATTCTTCCTGGTGGTGCTGGGATTTTGCCAGGAGCTGGAGGAGTTTACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42460
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 710 1079 31 52
Genomic Location (Zv9):
Chromosome 15 (position 176873)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 373399
GRCz11 15 282840
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTGAATGCTTTCAGGGCTAGCAGCTGGAGCCAAACCTCCTAAATATG[G/A]TAAGGGCTTGACTCTTTTCTGTTTCAGCTGTCTTGGCAGTGTTATTCAGC
Long Flanking Sequence:
TAACCAGGCTGGGAGCCCAGCCAAAACCAGCTGTGTCCAGCTTAAACCAGGCTGGTTTTAGCTGGTCATTTTCCAGCTTGACCAGCTAAGACCAGGCTGGAAATGGCTGGAAACCAGCCTGGAAATGAAAAAAAAAAAAAACCCTATAAAACCAGGCTGGTAAACCAACTAAAACCAGCCAACCAGCTTAGGCTGGTTTAAGCTGGATTTTTCAGCAGGGATAGCATATTCACAGCACTTTCACCAGACTATAGTAAGTACTGCATGAATAAATGAGCTGCTCACTGTGTGTAGGAGCTGGAGTTGCCCCAGGCTATGGTTCTGTGGCTGGGCTTGGAGGACAGCTTGGGGCTGGAGGTACCGTACATGTTTGAATGTCCCCATTTCTCACAATGGATGTTTGTCAGTTAAGCTAATTTTGTTTTTAGCATTGGAGAACATTTAGTCACAGTGTTGAATGCTTTCAGGGCTAGCAGCTGGAGCCAAACCTCCTAAATATG[G/A]TAAGGGCTTGACTCTTTTCTGTTTCAGCTGTCTTGGCAGTGTTATTCAGCTGTTTGTACATGTGTTGCTCTACAGTTTGTGTTTGAATGTTGTTTGTAATAGAAAATAGTTGTGCTGAGATCATAAAAACTGGTCCACTGACTGAGTGTGAATCGAGTATTGATCGGTCAGATATTATGCTTTGTGGCCGCAGGAGTGCCTGGAGGAACAGGTTTTGGAGTACCCGGAGGAGTCCCTGGAGGAATACCAATAACTGGACCAGGAGGTATGGCTGCTGCTTTCTGGAAAGCACAATGATATGAGAAGCTGAGTTTTATATCTAATTTTTAAACGTGTTTCTGAGGTTTTGAGGATTGTATTATGTTTCAATCTCTTCTTATTTCTATTTTTAAGGATACCCTGCTGGAGCCAAGGCTCTTAAATATGGTATTTATAATAGCTGATTAATTCTGTATTAACTAGTGTGTAGGCACATTAATCTCTCTGGCTAAATGTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11039
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 992 1079 46 52
Genomic Location (Zv9):
Chromosome 15 (position 185411)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 364861
GRCz11 15 274302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGGAGCGGGTGGTGTTGGMRGTGTTGGAGGACTSTATCCWGGAGCAG[G/A]TGAGACTTCATGCTAAACATCAGCACTTCACATATAATGTTGTGCATRGT
Long Flanking Sequence:
TTTCCTCATTCATTATTAAGGCCAATATTACGGTAGCGCTGGACCGTCTGGAGTCGGGACTGGTGTTTTACCTGGAGCCAAACCGCTGAAAGCCCCTGGTAAGATCACAGTATTTCACCTTCAGAGTTCTCCAGCAAGACTAGCAGTGCTCATGTGAACACAGGTGTTGAGTTTGACATCCAGGCTGCAGAAGAATCCAGAGGCCACATTAGCCTGCATTAGGTGCAGTTCTGGATGAATGTAAATGCAGTCAGATCCTCTGTAACTGGACATGCAAATATTAGTTTCACAGGAATATCTGCTCCACATGTAAATGTCTATGCTTGGAATCATGTCTTGACCTTACATTCATATTCCCGCACACAAATACAGTGCTCAACATTACTGAACACACACCCGCACTGTAGTCTTCTCTCAGTCTGCCTCTGCTTGACTCTGTGCATCAGGTGTTGGAGGAGCGGGTGGTGTTGGCGGTGTTGGAGGACTGTATCCTGGAGCAG[G/A]TGAGACTTCATGCTAAACATCAGCACTTCACATATAATGTTGTGCATGGTGCCAATAATACTGCACGGTAAAGAGAAAAGTGCAAAACCTGAAGCTTTATTCCTGCCCTGTTCACAAGATCTGAACCCAAATCTAAGTGGCCGTCACAGGGCGATGTGGAGAAAACCGTGACACACTTGTGGACCATGTAAACTGAGATCAGTGCACTGCAGCTGGACTGTGATCATACCTGCTCATGACTCTTCTCAGGAGTCTCCTGTATTCACACCAATCGTTCGCCACCCTCCCGCTGTGTTATTTCACCCAGAAAACTCATTATTGGCCTCATCAGCCTTCTCAACATCCCCCCTACCTGTCTTTAACTTTGGTACGGTCTCCCCCACCTAGCATTGAACCCTAAGCTAAGAGGCAGAACTCACCAGAACTCATTAGAATTGCCTTCAATACTCCTTTGTAAACACATTATAATGTAACACTGTTGGCAGACGAATAATACTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2811
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 1010 1079 47 52
Genomic Location (Zv9):
Chromosome 15 (position 187440)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 362832
GRCz11 15 272273
KASP Assay ID:
554-3112.1 (used for ordering genotyping assays)
KASP Sequence:
TGGACTGGGAACTGGTGGCGTGGGAACTGGTGCTAAACCACCAAAACCAG[G/A]TAGGACAACATATGACATTTAATGTCTGACAAWACAGACTATAGAGCGGT
Long Flanking Sequence:
TTAAGAGGAACACTTTTGTACTTTTTAGATACTAATATGTGCCCTTGACGTATTAATATGGACCTTTAAGGTACCAATTTGTACCTTTTGAAAAGGCACCACCACAGTGACAGCTCCCGTACCTTTATTTCTGAGAGTGTAGAAACAGCCCAACGGGTCAAAAACACAGGCAGAAACACTCAGAAATGACCGCAACAGCTGGACAAGACACATATTTACAGTCCAAGAGTTTAATGATAACGTCCTCGAGCTGCGTGTGGATTCAGGGTGACCTTGATTGATGGGATATGTGGTTTGGAAGGACGCAGGCACACATTTGTTTGCTAGTCATGTGAACAGCAGACAGACAGTAGCAGTAATGTCCGTCCACATGGAGAAAATGCGCTGAGAATAGAGTGTGTGCTGTGGATATCGGGCTGTTGCTGAGTCTACTCCTCTCGCTACAGGTGTTGGACTGGGAACTGGTGGCGTGGGAACTGGTGCTAAACCACCAAAACCAG[G/A]TAGGACAACATATGACATTTAATGTCTGACAATACAGACTATAGAGCGGTGTTTTATAAGTGGATCATGCCAGATGAACTCCAGACATACTCTCTCTGTGCTCACTCAAGCTTCAGTCGAAGCCATGGCTGACCCGAGAGTGATGTACTGGTGATTGACTCACCCTCGTGATGCTGGAGATGAAGGTGGTGTTGTTCATCAGTACACCACTGCAGATGATTTTAGCTGAGTGTGTGGTTATTGGTGACTATAGTTACAGGTTATTATGAAGAATAAACACCTATAAGCAAGTCCAAATCCGTCCCTTCCTGCACAGAGCGCTGGTTTGGCTTCAGCAGAGCTCAGTGTGTCTTCAGGAGACAGCAGGATGGATGTGGACATGTTTGTTTGTGTTTATTTTCCACTGATTTACATCATACGAGTCACTGGAACCGCACAGATTCAGCTCAGACTCTGCTTTAATGATGGACATGAGCAGATTCACAGGAATCGGTGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42461
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 1034 1079 49 52
Genomic Location (Zv9):
Chromosome 15 (position 188977)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 361295
GRCz11 15 270736
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTTCTCTGCAGGCGGTGTAGCTGCTGGAGGATACGGAGCTTATCCAG[G/A]TAATGCTTTAGTGAAATAATAATACAACATATAACACAGTGTCTTCTGAT
Long Flanking Sequence:
TGTGAAGGATGCGTTCTCATAGTCATAGTCAATCCAGGAAATCAGCACAAATTCGAGAATCATTTCTGACGTTCTCAGCTGCTCTCAATGCCTTTCTGTGCTGTGTTCACTCCCATAATGCACTGCATGAGTGCTCAACTTCCATATGAATGAACTGAAAACACACACTACACACTTTCATATCAGTTAAAGGGTCAGTTCACACACACACACACACACACACACACACACACACACACACATGAAAATTTACTCATTATTTACTCTCCTCAAGTGCTTCCTAACCTTTACGAGTTTCTTTATTCTGTTTAACCCTAATCAAGATTTAAAATAATGAATTAATTTTTAATCTTTCTTCAGAAAATCCTAATTTGTGTTTGACATAAGAAAGAAACTGGTAAAGAAATGCAGGAGTGAGTGATCTCCTGTTCATGTGTAAATCTCCATCTCTCTCTTCTCTGCAGGCGGTGTAGCTGCTGGAGGATACGGAGCTTATCCAG[G/A]TAATGCTTTAGTGAAATAATAATACAACATATAACACAGTGTCTTCTGATGGAGTTCAGCTTGTTCTAGTGCAGGGCTATTCAATTAGACTATCATGGGGGCCAGTTCATGTAAAGCATGCTAACTGAGGGGCCGGAGAGAGATGACTTGCAATATGAGTGATGACACAACTGCATATACTGTATGAGCCCATATGCTGTGCTTTTCTCCTTAAGACACCCATGCTGGCTTTGTCTACATTTATATATTAATATGCTGAACTTTATAACTAAATCTAGTTTTGATATCATCGGTGCACTGTCTGGAGGGCCGGAACAGATTGCCTCTGAATTGAATAGCCCTGTTCGGTGGTCTTCAGGGTCATTTATACACTGCAGACATGCTTTTCGGTCTTACCACGAGTCCAAATATCCACCAACTCCTAAATCAAGAAGCATTTTCTAGACAAGAACATAATATTGTGTTGTTTTCAGAAATAATGAGTCAAAACTAATCGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 1038 1079 50 52
Genomic Location (Zv9):
Chromosome 15 (position 190497)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 359775
GRCz11 15 269216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTTAGACTCATCTCTCTCCTCTGTTTCTGTGTTTCAGGAGGATAT[G/T]GAGCAGGACTATCCCCACAGCAGGGTACGACCTCTACATAACGCACCTTC
Long Flanking Sequence:
TTATTATTAGTATTATTATTATTAGTATTATTATTAGTATCATTATTTTATTGTTATTATTATTAACATTAGTAGTATTATTATTAGTATAATTATAATATTAATTATTATTATTCTTATTATTATTATTACAGATGCTGTTGGTCACAGTTGGCCATTAATCTCCTCGCTTAAAATGCTTTTCTTACTCAGAGTTTTTGTCTTGCTTTCAGAAATAAAAAGTCAAAATTAAGTGCTGAACTTCCCTCATTGTCAGATTATCCTGCCTGTTTTAAAGAGAAACTCTCTTCATTTTGACTCATTATTTCTTGAAACAAGACCATATGCTGTGCTTGTCAAGACAATGCTTCTTGATTTAGCAGTTTGTAGATGTTTGGACTAGAACCAAGACAAACTCAGAGTCAGACAGCTTGTTCTGCTTTTGTTTCACTGATATTCTTTGTTTAATTTGCAGAGTTAGACTCATCTCTCTCCTCTGTTTCTGTGTTTCAGGAGGATAT[G/T]GAGCAGGACTATCCCCACAGCAGGGTACGACCTCTACATAACGCACCTTCAGCTTGACATGGTCTTCTCACCTCTGCATGCACTCTTTGAACACAGGCTAATACCAGGTTGTCTGTAGATATATAATGATCTTTCACCTATTCTTCTTTCCTCAGCCAAAGCAGCTAAATACGGTGGTGGACTGACAGGGTTCCTGGGAGGAGGGTATCGAGGTACGACAGAATTAATCCCTGCTGCCTCATGATCACTGATTCCTCATGATCACTGCGGTGTTTCTGACGGACGTCCCAGACTATACGCTCTGATCACGGCAGACACTGCATGGCCTTCTGCTGCTGACCATTACTACAATATACACACATACATGAGTAACTGAAGAAGAGCGATTCCACATCGAACAGACACATTCCTGGCCGTGTAAAATCTGTGGAAATCTGTCAGCACTTTGTTCCAAACCCACTCCGTTTGGCACAACCGCACATGAAAAACTGCAGTCATTT
Associated Phenotype:
Not determined