Busch Lab

ZMP

il21r

Ensembl ID:
ENSDARG00000069961
ZFIN ID:
ZDB-GENE-080108-6
Description:
interleukin-21 receptor [Source:RefSeq peptide;Acc:NP_001106982]
Human Orthologue:
IL21R
Human Description:
interleukin 21 receptor [Source:HGNC Symbol;Acc:6006]
Mouse Orthologue:
Il21r
Mouse Description:
interleukin 21 receptor Gene [Source:MGI Symbol;Acc:MGI:1890475]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33294 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33294
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102243 Essential Splice Site 19 508 1 7
Genomic Location (Zv9):
Chromosome 3 (position 45398450)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47408003
GRCz11 3 45360337
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATGGCGAGCCACATTCTTGCTTGTTGTTTGTGGACTTCTACAGTGCT[G/T]TAAGTCTACATCTATTGCAGCACATTTGGTTTCTAAAAAATCAAAGCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8144
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102243 Nonsense 448 508 7 7
Genomic Location (Zv9):
Chromosome 3 (position 45382632)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47392185
GRCz11 3 45344519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTACAGCTCTAATGAGCARTCCGATGAYGGTTACCCACAAATGGGGT[T/A]GGATCTGGACACCATAGACAGTGGGTTTCTGGAGTCGGAGTGTTCGAGCC
Associated Phenotype:
Not determined