Busch Lab

ZMP

si:dkey-7m11.2

Ensembl ID:
ENSDARG00000069953
ZFIN ID:
ZDB-GENE-090312-178
Description:
Novel protein similar to H.sapiens KCNQ5, potassium voltage-gated channel, KQT-like subfamily, membe
Human Orthologue:
KCNQ5
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 5 [Source:HGNC Symbol;Acc:6299]
Mouse Orthologue:
Kcnq5
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 5 Gene [Source:MGI Symbol;Acc:MGI:1924937]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa19519 Nonsense Available for shipment Available now
sa39631 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19518 Nonsense Available for shipment Available now
sa39630 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 226 974 4 14
ENSDART00000148069 Nonsense 109 538 3 13
Genomic Location (Zv9):
Chromosome 1 (position 30227346)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30367158
GRCz11 1 31171089
KASP Assay ID:
2259-0715.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTTTTGCAACGTCTGCTCTGCGAAGCTTAAGATTTCTACAAATCCTG[C/T]GAATGGTACGCATGGACCGCCGCGGAGGAACTTGGAAGCTTCTGGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39631
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Essential Splice Site 249 974 4 14
ENSDART00000148069 Essential Splice Site 132 538 3 13
Genomic Location (Zv9):
Chromosome 1 (position 30227273)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30367085
GRCz11 1 31171016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAGGAACTTGGAAGCTTCTGGGATCTGTAGTTTATGCACACAGCAAGG[T/C]AACTTGATTTTTGACAAATTGTCATCTAAAATTATTTAAAAGGTTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 331 974 7 14
ENSDART00000148069 Nonsense 214 538 6 13
Genomic Location (Zv9):
Chromosome 1 (position 30222545)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30362357
GRCz11 1 31166288
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTTGTCCATTTTTCATGATATGGTTCTTTTTCACTTGCAGGGTATTT[T/A]GGGTTCAGGTTTTGCCTTGAAGGTTCAAGAGCAGCACAGACAGAAGCACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25604
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Essential Splice Site 475 974 10 14
ENSDART00000148069 Essential Splice Site 358 538 9 13
Genomic Location (Zv9):
Chromosome 1 (position 30210548)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30350360
GRCz11 1 31154291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCCCTCCCTCCGTCTCAAGAGCCAATCACGGTCCACGCCCGAAGG[T/G]GAATTACTTTCTGATTGGAGGATTTTTTTTTTTTTTTTTTTTTGTTGCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7907
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 529 974 12 14
ENSDART00000148069 Nonsense 412 538 11 13
Genomic Location (Zv9):
Chromosome 1 (position 30202597)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30342409
GRCz11 1 31146340
KASP Assay ID:
2259-0712.1 (used for ordering genotyping assays)
KASP Sequence:
ATGAAATTCCATGTGGCAAAGAAGAAGTTTAAGGAAACTCTGCGCCCATA[T/A]GATGTGAAGGATGTAATAGAGCAATATTCAGCTGGTCATCTGGACATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39630
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 681 974 14 14
ENSDART00000148069 None None 538 None 13
Genomic Location (Zv9):
Chromosome 1 (position 30192820)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30332632
GRCz11 1 31136563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAGGGCCCTCCAGCTAATATTAGCCCCCAATGAACTCATGAACCTCAAC[C/T]AGAACAACTCCACAACATCTTCCCCAGGACTCAACCCAGCGTCCGCCTCC
Associated Phenotype:
Not determined