Busch Lab

ZMP

itga6b

Ensembl ID:
ENSDARG00000069946
ZFIN ID:
ZDB-GENE-050320-5
Description:
integrin, alpha 6b [Source:RefSeq peptide;Acc:NP_001013466]
Human Orthologue:
ITGA6
Human Description:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
Mouse Orthologue:
Itga6
Mouse Description:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16239 Nonsense Available for shipment Available now
sa10618 Nonsense Available for shipment Available now
sa1967 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3354
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 152 1085 4 25
Genomic Location (Zv9):
Chromosome 1 (position 30092847)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30232659
GRCz11 1 31036590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTTATTTGTTGGCTCAGTTCAGGAACTGCGTGACTTGACAGGTCGKTG[C/A]TATGTACTTAGTGAGGATGTGACGATTAATGAGATCTCAGATGAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16239
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 202 1085 4 25
Genomic Location (Zv9):
Chromosome 1 (position 30092997)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30232809
GRCz11 1 31036740
KASP Assay ID:
2259-0705.1 (used for ordering genotyping assays)
KASP Sequence:
GGATCATGCCAGCAGGGCATGTCCGCCACRTTCACAAAGGACTATCACTA[T/G]CTGGTGTTTGGAGCACCAGGCGCTTACAACTGGAAAGGTATTAAAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10618
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 418 1085 8 25
Genomic Location (Zv9):
Chromosome 1 (position 30098702)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30238514
GRCz11 1 31042445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATATGACAGCAATGGAGCTGGAAACRTGATTATCTTCCACGGTTCACCA[C/T]AAGGACTGAAAAAATCCCAGGTGCAGCCATATATCCACTTTACTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1967
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 772 1085 18 25
Genomic Location (Zv9):
Chromosome 1 (position 30110974)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30250786
GRCz11 1 31054717
KASP Assay ID:
554-2453.1 (used for ordering genotyping assays)
KASP Sequence:
TATAAAAAATGTATRTGACTTGAAGTGTTGTAATTTGCAGGACAAGTGAA[C/T]AGAAGCAATTGCAAGCAGTCAAAGCCAAAGCCATTGTTAAGATCCAGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25603
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Essential Splice Site 956 1085 22 25
Genomic Location (Zv9):
Chromosome 1 (position 30116345)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30256157
GRCz11 1 31060088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTGTTATTAGTCTGCGTGCTTACCTTTGGAATGCCACTTTCCTGGAG[G/T]TGAGTGGCACTCTTGATTTTGTGATGTATTAAAACCTATTCACATTTAAT
Associated Phenotype:
Not determined