Busch Lab

ZMP

dnm2

Ensembl ID:
ENSDARG00000069937
ZFIN ID:
ZDB-GENE-050913-84
Description:
dynamin-1 [Source:RefSeq peptide;Acc:NP_001025299]
Human Orthologue:
DNM2
Human Description:
dynamin 2 [Source:HGNC Symbol;Acc:2974]
Mouse Orthologue:
Dnm2
Mouse Description:
dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa20128 Nonsense Available for shipment Available now
sa20129 Essential Splice Site Available for shipment Available now
sa13248 Nonsense Available for shipment Available now
sa13768 Nonsense Available for shipment Available now
sa17720 Essential Splice Site Available for shipment Available now
sa9093 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16501 Essential Splice Site Available for shipment Available now
sa20130 Nonsense Available for shipment Available now
sa15133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20128
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 25 755 1 18
ENSDART00000097146 Nonsense 25 872 1 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48319404)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50320544
GRCz11 3 47131184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGATCCCCCTGATCAATAAACTCCAAGATGCTTTCAGCTCCATTGGC[C/T]AAAGTTGTAACCTGGATCTGCCGCAGATAGCAGTTGTCGGAGGACAGAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3440
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 99 755 3 18
ENSDART00000097146 Nonsense 99 872 3 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48352509)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50353649
GRCz11 3 47164289
KASP Assay ID:
2259-4050.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTCCTACACTGCAAAGGGAGGAAGTTCGTGGACTTTGATGAAGTCCGG[C/T]AGGAGATTGAAGCAGAAACCGACAGGATTACAGGCTCCAATAAGGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20129
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Essential Splice Site 129 755 3 18
ENSDART00000097146 Essential Splice Site 129 872 3 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48352601)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50353741
GRCz11 3 47164381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGCATCTCTCCTATCCCCATCAACCTGAGAGTCTACTCTCCTAACGG[T/C]AATGCAAAACTAGACCCTGGAGGAGCGCAGTTTCCCGCAGTCAGTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13248
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 130 755 4 18
ENSDART00000097146 Nonsense 130 872 4 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48352694)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50353834
GRCz11 3 47164474
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCTGCTATTGGTRAAAWGTCACTCTCCTCTGTCTTTGATCAMCAGTAT[T/A]GAATCTGACACTCATCGATTTGCCTGGGAYGACGAAGGTGGCAGTGGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 265 755 6 18
ENSDART00000097146 Nonsense 265 872 6 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48355835)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50356975
GRCz11 3 47167615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTGCTGCGMTGGCAGCAGAAAGGAAGTDTTTCCTGTCCCACCCTAGTTA[C/A]AGACATATGGCTGAAAGGATGGGAACGCCACACCTGCAAAAAGCCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17720
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Essential Splice Site 331 755 8 18
ENSDART00000097146 Essential Splice Site 331 872 8 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48358454)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50359594
GRCz11 3 47170234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYGCTCGTAACTAATTCTAGCAGTTTCTAACTCTGAGTTCTGCTTTTTTA[G/T]RATGGTCCAGCAATTTGGTGTGGACTTTGAGAAGTGCATTGAGGGRTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9093
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Essential Splice Site 498 755 None 18
ENSDART00000097146 Essential Splice Site 498 872 None 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48368301)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50369441
GRCz11 3 47180081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGTCATACATCAACACCAACCACGAGGACTTCATTGGATTTGCAAAG[T/A]ATGYGTTGCATTCAGTGCAGTCATTTTTTTTTTTTTTTGGCNTTTGTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26143
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 None None 755 None 18
ENSDART00000097146 Essential Splice Site 515 872 14 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48373110)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50374250
GRCz11 3 47184890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCAAAACTCGCCCCCACCCCCTTCCCCCTCCCTCTTACTTATCACTAC[A/G]GGGTGAAATCCTGGTAAGTACCATAAACTTACAAGCCACACCCAGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 None None 755 None 18
ENSDART00000097146 Essential Splice Site 518 872 14 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48373125)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50374265
GRCz11 3 47184905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACCCCCTTCCCCCTCCCTCTTACTTATCACTACAGGGTGAAATCCTGG[T/A]AAGTACCATAAACTTACAAGYCACACCCAGTTAAAGGTCACCAGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20130
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 594 755 16 18
ENSDART00000097146 Nonsense 598 872 17 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48386994)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50388134
GRCz11 3 47198774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGTGGCTTCATGTGTTCGATCCCCCTCGCAGGAATGTGTATAAGGACT[T/A]GCGTCAGATCGAGCTGGCCTGTGACTCGCAGGAGGACATGGATAGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15133
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 648 755 17 18
ENSDART00000097146 Nonsense 656 872 18 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48389670)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50390810
GRCz11 3 47201450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCCCAGCCGACAGCTTCTCCATGGACCCTCAGTTGGAAAGACAGGTC[G/T]AGACCATCCGTAACCTGGTGGACTCCTATATTGGAATCRTCAACAAAACC
Associated Phenotype:
Not determined