Busch Lab

ZMP

ENSDARG00000069904

Ensembl ID:
ENSDARG00000069904
Human Orthologues:
COL19A1, COL21A1, COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
collagen, type XIX, alpha 1 [Source:HGNC Symbol;Acc:2196]
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]
Mouse Orthologues:
Col19a1, Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]
collagen, type XIX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095415]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24419 Nonsense Mutation detected in F1 DNA Not yet available
sa25200 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5067
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 199 606 1 14
Genomic Location (Zv9):
Chromosome 23 (position 46278369)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46163836
GRCz11 23 46115062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCTGGACATCTACCCATCWGCCCAGGCTGCGGCACACTACTGCCAGTA[T/A]CTTAAAAAACAGTGCAGACTGTCGGACACCTTCCGATCTCAGTCCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24419
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 293 606 1 14
Genomic Location (Zv9):
Chromosome 23 (position 46278089)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46163556
GRCz11 23 46114782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCAGGCAAGAGTCTCGATGCTGAAAACGAGACCGAGGATCATCATCTT[A/T]AGAAGCCGAGAGGGACTCGATCCACCCCAGATCTGATCTCCATCATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25200
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 466 606 6 14
Genomic Location (Zv9):
Chromosome 23 (position 46233562)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46119029
GRCz11 23 46070255
KASP Assay ID:
554-7890.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGATCATAATCCGCATCTGTTTTCCTCCATTGTAGGGTCCCAAAGGCTA[T/A]CCAGGACCCGCAGGTCTGCCCGGAGAACAGGTGAGTTGATGAAACGCACC
Associated Phenotype:
Not determined