Busch Lab

ZMP

si:ch73-257c13.3

Ensembl ID:
ENSDARG00000069808
ZFIN ID:
ZDB-GENE-081104-270
Description:
Novel protein similar to vertebrate osteopetrosis associated transmembrane protein 1 (OSTM1) [Source
Human Orthologue:
OSTM1
Human Description:
osteopetrosis associated transmembrane protein 1 [Source:HGNC Symbol;Acc:21652]
Mouse Orthologue:
Ostm1
Mouse Description:
osteopetrosis associated transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:2655574]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14055 Nonsense Available for shipment Available now
sa37077 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14055
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101887 Nonsense 90 329 1 6
ENSDART00000145269 Nonsense 72 311 1 6
Genomic Location (Zv9):
Chromosome 20 (position 32517251)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32575491
GRCz11 20 32478370
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTATCAAAGGCGAACAGTTTRGAGTTTTTCTACTCTCTCAGCCTTTCAT[C/A]ATTTCCAGAGGACTTGGAAGTGAACGAGTATTGTATTGAACTGCTTCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101887 Nonsense 129 329 1 6
ENSDART00000145269 Nonsense 111 311 1 6
Genomic Location (Zv9):
Chromosome 20 (position 32517369)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32575609
GRCz11 20 32478488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACTTTCGCTAACTGTCTTGTGTTTTATGCACGACCTGTCAAAGTCTG[T/A]CAGAACTGTTACACTGGCTTTAAAGGTCTGAAGGAGATATATCTAAATAT
Associated Phenotype:
Not determined