Busch Lab

ZMP

zgc:173573

Ensembl ID:
ENSDARG00000069796
ZFIN IDs:
ZDB-GENE-050306-3, ZDB-GENE-071004-105, ZDB-GENE-071004-105
Description:
Zgc:173573 [Source:UniProtKB/TrEMBL;Acc:A9JRM8]
Human Orthologues:
ZFP62, ZNF268, ZNF585A, ZNF585B, ZNF624
Human Descriptions:
zinc finger protein 268 [Source:HGNC Symbol;Acc:13061]
zinc finger protein 585A [Source:HGNC Symbol;Acc:26305]
zinc finger protein 585B [Source:HGNC Symbol;Acc:30948]
zinc finger protein 62 homolog (mouse) [Source:HGNC Symbol;Acc:23241]
zinc finger protein 624 [Source:HGNC Symbol;Acc:29254]
Mouse Orthologues:
5430403G16Rik, Gm13212, Gm14124, Gm14295, Zfp26, Zfp27, Zfp619, Zfp62, Zfp658, Zfp788, Zfp808, Zfp873
Mouse Descriptions:
RIKEN cDNA 5430403G16 gene Gene [Source:MGI Symbol;Acc:MGI:1924450]
predicted gene 13212 Gene [Source:MGI Symbol;Acc:MGI:3651014]
predicted gene 14124 Gene [Source:MGI Symbol;Acc:MGI:3652002]
predicted gene 14295 Gene [Source:MGI Symbol;Acc:MGI:3709624]
zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]
zinc finger protein 27 Gene [Source:MGI Symbol;Acc:MGI:99174]
zinc finger protein 619 Gene [Source:MGI Symbol;Acc:MGI:1917477]
zinc finger protein 62 Gene [Source:MGI Symbol;Acc:MGI:99662]
zinc finger protein 658 Gene [Source:MGI Symbol;Acc:MGI:2652821]
zinc finger protein 788 Gene [Source:MGI Symbol;Acc:MGI:1914857]
zinc finger protein 80 Gene [Source:MGI Symbol;Acc:MGI:3704127]
zinc finger protein 873 Gene [Source:MGI Symbol;Acc:MGI:3040689]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa2119 Nonsense F2 line generated Not yet available
sa38415 Nonsense Mutation detected in F1 DNA Not yet available
sa11168 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2119
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 215 1014 1 5
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 215 1014 1 5
Genomic Location (Zv9):
Chromosome 3 (position 62970756)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62071861
GRCz11 3 62308491
KASP Assay ID:
554-3247.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAACCATTCACATGCACTCATTGTGGGAAGAGTTTCGGCCAATCATCA[C/T]AATTTAATAATCACATGAGGATCCACACTGGAGAGAAACCRTTCACATGC
Long Flanking Sequence:
TTATTCAACACATGAGGAGCCACACTGGAGAGAAACCATACACATGCACTCAATGTGGGAAGAGTTTCAGCCAGTCATCAAACTTTAATTTACACATGATGAACCACACTGGAGAGAAACCATACACATGTACCCAATGTGGGAAGAGTTTCAGCCAATCATCACACCTTAATATACACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAAAAGTTTCAGCCAATCATCAAACCTAAATTATCACATGAAGATCCACACTGGAGAGAAACCATTCGCATGCACCCAATGTGGGAAGAGCTTTATCAGATCAAGACACCTTAATCTGCACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAAGAGTTTCAGCCAGTCATCAAACTTTAATTTACACATGATGAGCCACACCGGAGAGAAACCATTCACATGCACTCATTGTGGGAAGAGTTTCGGCCAATCATCA[C/T]AATTTAATAATCACATGAGGATCCACACTGGAGAGAAACCGTTCACATGCACTCAGTGTGGGAAGAGTTTCAGCCAATTATCCAACCTTAATAATCACATGAGGATCCACACTGGAGAGAAACCATACACATGCACTCAGTGTGGGAAGAGTTTCAGCCAATTATCTAACCTTAAAAATCACATGAAGATTCACACTGGAGAGAAACCATTTACATGCACTCAGTGTGGGAAGACTTTCAACTACTCATCAACCCTTAATCAACACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAGGGGTTTCAGCCAAATGTCATCCCTTAGTAAACACAAAAATATCCACACTTGAGAGAAACCATTCACTTGCACTTAAGCTGCGGTCACACTGGACTTTTCTCCCCATAGACTTCCATACTTACGCGCGGATCGGAAATGCAAGTTCATGCCTTAAGTTTCGCAGTTCACTGTGTTGCAAAGTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5734
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 215 1014 1 5
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 215 1014 1 5
Genomic Location (Zv9):
Chromosome 3 (position 62970756)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62071861
GRCz11 3 62308491
KASP Assay ID:
554-3247.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAACCATTCACATGCACTCATTGTGGGAAGAGTTTCGGCCAATCATCA[C/T]AATTTAATAATCACATGAGGATCCACACTGGAGAGAAACCRTTCACATGC
Long Flanking Sequence:
TTATTCAACACATGAGGAGCCACACTGGAGAGAAACCATACACATGCACTCAATGTGGGAAGAGTTTCAGCCAGTCATCAAACTTTAATTTACACATGATGAACCACACTGGAGAGAAACCATACACATGTACCCAATGTGGGAAGAGTTTCAGCCAATCATCACACCTTAATATACACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAAAAGTTTCAGCCAATCATCAAACCTAAATTATCACATGAAGATCCACACTGGAGAGAAACCATTCGCATGCACCCAATGTGGGAAGAGCTTTATCAGATCAAGACACCTTAATCTGCACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAAGAGTTTCAGCCAGTCATCAAACTTTAATTTACACATGATGAGCCACACCGGAGAGAAACCATTCACATGCACTCATTGTGGGAAGAGTTTCGGCCAATCATCA[C/T]AATTTAATAATCACATGAGGATCCACACTGGAGAGAAACCGTTCACATGCACTCAGTGTGGGAAGAGTTTCAGCCAATTATCCAACCTTAATAATCACATGAGGATCCACACTGGAGAGAAACCATACACATGCACTCAGTGTGGGAAGAGTTTCAGCCAATTATCTAACCTTAAAAATCACATGAAGATTCACACTGGAGAGAAACCATTTACATGCACTCAGTGTGGGAAGACTTTCAACTACTCATCAACCCTTAATCAACACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAGGGGTTTCAGCCAAATGTCATCCCTTAGTAAACACAAAAATATCCACACTTGAGAGAAACCATTCACTTGCACTTAAGCTGCGGTCACACTGGACTTTTCTCCCCATAGACTTCCATACTTACGCGCGGATCGGAAATGCAAGTTCATGCCTTAAGTTTCGCAGTTCACTGTGTTGCAAAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38415
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 311 1014 1 5
Genomic Location (Zv9):
Chromosome 3 (position 62971044)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62072149
GRCz11 3 62308779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACTACTCATCAACCCTTAATCAACACATGAGGATCCACACTGGAGAG[A/T]AACCATTCACATGCACTCAGTGTGGGAGGGGTTTCAGCCAAATGTCATCC
Long Flanking Sequence:
CATTCGCATGCACCCAATGTGGGAAGAGCTTTATCAGATCAAGACACCTTAATCTGCACATGAGGATCCACACTGGAGAGAAACCATTCACATGCACTCAGTGTGGGAAGAGTTTCAGCCAGTCATCAAACTTTAATTTACACATGATGAGCCACACCGGAGAGAAACCATTCACATGCACTCATTGTGGGAAGAGTTTCGGCCAATCATCACAATTTAATAATCACATGAGGATCCACACTGGAGAGAAACCGTTCACATGCACTCAGTGTGGGAAGAGTTTCAGCCAATTATCCAACCTTAATAATCACATGAGGATCCACACTGGAGAGAAACCATACACATGCACTCAGTGTGGGAAGAGTTTCAGCCAATTATCTAACCTTAAAAATCACATGAAGATTCACACTGGAGAGAAACCATTTACATGCACTCAGTGTGGGAAGACTTTCAACTACTCATCAACCCTTAATCAACACATGAGGATCCACACTGGAGAG[A/T]AACCATTCACATGCACTCAGTGTGGGAGGGGTTTCAGCCAAATGTCATCCCTTAGTAAACACAAAAATATCCACACTTGAGAGAAACCATTCACTTGCACTTAAGCTGCGGTCACACTGGACTTTTCTCCCCATAGACTTCCATACTTACGCGCGGATCGGAAATGCAAGTTCATGCCTTAAGTTTCGCAGTTCACTGTGTTGCAAAGTTCAAGCTTGGTGAACTGTCACCTGTGAAATTGCATCACTTGACGGTGACTTTCCAAGAACGCAGAGAACTGACTTGCGTTCTTGTGGAGAGCGGTCTTGCCAGGTGTCCTCGGAAGAACGAACTTGGGAGACCGCGAGGGCAGAGAACGCGTCCTCTGAGAAATGAGATGCTGCGTTCTTCCTGATGCTCACATGGCCTTCACATGTTTTTAATGGAAAATTATTTAAACATTACAGCATTCATACAACGATTCATTGTTTTTCCCCTTTTAAAAATTTATACAATGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11168
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 538 1014 2 5
Genomic Location (Zv9):
Chromosome 3 (position 62976815)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62077920
GRCz11 3 62314550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATCACACCTTAATGAYCACATGAAGATCCACACTGGTGTAAAAGAGTA[T/A]ATGTGCTTTGAGTGTGACAAGACTTTTATTAAAGCTGGAGAATTGAAAYA
Long Flanking Sequence:
TGCACTCAGTGTGGGAGGAGTTTTAGCCAATCACAAAATCTTCAAAAACACATGGTGATCCACACTGGAGAGAGACCATACACATGCATTCAGTGTGGGAAGAGTTTCAGCCAACCACCATCACTTTATACACACATGAGGATCCACACTGGAGAGAAACCATACACATGCACTCAGTGTGGGAAGAGTTTCAGCCAAACATCACACCTTATTAAACACATGAGGATCCACACTGGAGAGAAACCATTTCCATGCACTCAGTGTGGGAAGAGTTTTAGCCAATCACCATCACTTTATGCACACATGAGGATCCACACTGGCGAGAAGCCATTCACTTGCACTCAGTGTGGGAAGAGATTCAGCCAATCATCACACCTTATTAAACACATGAGGATCCACACTGGAGAAAAACCATTTCCATGCACTCGGTGTGGGAAGAGTTTCAGTCGATCATCACACCTTAATGACCACATGAAGATCCACACTGGTGTAAAAGAGTA[T/A]ATGTGCTTTGAGTGTGACAAGACTTTTATTAAAGCTGGAGAATTGAAACAGCACCAGAGGGTTCACACTGGAGAAAAACCGTACGAGTGTTCACACTGCAATAAGAGATTTGGTGGTTTAGGAACCCTGAAAAAACATGAGAGGATCCACACTGGAGAGAAACCGTACGAATGTTCACTCTGCAATAAGAGATTTAATTGCACAGGAACCCTGAAAAAACATGTGAGGACTCACACTGGAGAGAAACCGTACGAGTGTTCACACTGCAATAAGAGATTTAGTTGCTCAGGAACCCTGACAAAACATGAGAGAATTCACACTCGAGAGAAACAATAGACATGATCAGAATCTTTAGAGCAGGGGTCACCAATCTCGGTCCTGAAGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGCCTCAACACACCTGCCTGGATGATTCAAGTATACGTAGTAAGAGCTTGATTAGCTTGTTCAGGTGTCTTTGATTAGGGTTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3447
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719 None None 305 None 3
ENSDART00000074170 None None 309 None 4
ENSDART00000112516 None None 305 None 3
ENSDART00000125238 Nonsense 555 1014 2 5
Genomic Location (Zv9):
Chromosome 3 (position 62976864)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62077969
GRCz11 3 62314599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATGTGCTTTGAGTGTGACAAGACTTTTATTAAAGCTGGAGAATTGAAA[C/T]AGCACCAGAGGGTTCACACTGGAGAAAAACCGTACGAGTGTTCACACTGC
Long Flanking Sequence:
ACATGGTGATCCACACTGGAGAGAGACCATACACATGCATTCAGTGTGGGAAGAGTTTCAGCCAACCACCATCACTTTATACACACATGAGGATCCACACTGGAGAGAAACCATACACATGCACTCAGTGTGGGAAGAGTTTCAGCCAAACATCACACCTTATTAAACACATGAGGATCCACACTGGAGAGAAACCATTTCCATGCACTCAGTGTGGGAAGAGTTTTAGCCAATCACCATCACTTTATGCACACATGAGGATCCACACTGGCGAGAAGCCATTCACTTGCACTCAGTGTGGGAAGAGATTCAGCCAATCATCACACCTTATTAAACACATGAGGATCCACACTGGAGAAAAACCATTTCCATGCACTCGGTGTGGGAAGAGTTTCAGTCGATCATCACACCTTAATGACCACATGAAGATCCACACTGGTGTAAAAGAGTATATGTGCTTTGAGTGTGACAAGACTTTTATTAAAGCTGGAGAATTGAAA[C/T]AGCACCAGAGGGTTCACACTGGAGAAAAACCGTACGAGTGTTCACACTGCAATAAGAGATTTGGTGGTTTAGGAACCCTGAAAAAACATGAGAGGATCCACACTGGAGAGAAACCGTACGAATGTTCACTCTGCAATAAGAGATTTAATTGCACAGGAACCCTGAAAAAACATGTGAGGACTCACACTGGAGAGAAACCGTACGAGTGTTCACACTGCAATAAGAGATTTAGTTGCTCAGGAACCCTGACAAAACATGAGAGAATTCACACTCGAGAGAAACAATAGACATGATCAGAATCTTTAGAGCAGGGGTCACCAATCTCGGTCCTGAAGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGCCTCAACACACCTGCCTGGATGATTCAAGTATACGTAGTAAGAGCTTGATTAGCTTGTTCAGGTGTCTTTGATTAGGGTTGGAGCTAAAACCTGCAGGACACCAGCCCTCCAGAAACAAGTTTGGTGACCC
Associated Phenotype:
Not determined