Busch Lab

ZMP

zgc:172158

Ensembl ID:
ENSDARG00000069775
ZFIN ID:
ZDB-GENE-080220-36
Description:
hypothetical protein LOC100005140 [Source:RefSeq peptide;Acc:NP_001107129]
Human Orthologue:
FBXO40
Human Description:
F-box protein 40 [Source:HGNC Symbol;Acc:29816]
Mouse Orthologue:
Fbxo40
Mouse Description:
F-box protein 40 Gene [Source:MGI Symbol;Acc:MGI:2443753]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10694 Nonsense Available for shipment Available now
sa12370 Nonsense Available for shipment Available now
sa32347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10694
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 273 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843789)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22692202
GRCz11 21 22728807
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGTCTTACAGGAAGAGCCAGAACAAAATATCAATCCTACCGATGTTCCT[C/T]AATACAACGCTTATGAAACGGATGATGAGAAATTCCTAATCGCTTCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12370
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 403 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843399)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22691812
GRCz11 21 22728417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATAATGGACACAGGAACTCAGACGTATGATTTCTACACGRCACCCTTC[A/T]AAGCAGAGGCGTCGCTGGCTGATATCACTGCTGACCGGCCGTTAAAAYTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3137
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 426 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843330)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22691743
GRCz11 21 22728348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATATCACTGCTGACCGGCCGTTAAAACTTCACGTCCACATTCAGGCK[G/T]AAAGTGCCACCAGAAGACACAACAAATCCAGCTCTGCGTTCACATACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 470 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843196)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22691609
GRCz11 21 22728214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCACTACAAAAACACCCATGCTGACATCCAGAGCTGCATCAGTGGATG[G/A]TTTGAACAGCGATGTCCTCTTTCTTACCTTGGCTGCACTTTCATTCAGAG
Associated Phenotype:
Not determined