Busch Lab

ZMP

etv5a

Ensembl ID:
ENSDARG00000069763
ZFIN ID:
ZDB-GENE-030131-9572
Description:
ETS translocation variant 5 [Source:RefSeq peptide;Acc:NP_001119933]
Human Orthologue:
ETV5
Human Description:
ets variant 5 [Source:HGNC Symbol;Acc:3494]
Mouse Orthologue:
Etv5
Mouse Description:
ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa279 Nonsense F2 line generated Not yet available
sa41407 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16031 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa279
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101770 Nonsense 20 522 3 13
ENSDART00000126015 Nonsense 20 524 3 13
ENSDART00000139434 Nonsense 19 97 3 6
ENSDART00000145005 Nonsense 19 180 3 7
Genomic Location (Zv9):
Chromosome 9 (position 23667593)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22823379
GRCz11 9 22634248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAAAACTGGGTGACACTAACCAACGTGTTTTTCCATAGCAGAAGTCAT[T/A]GCAAGTGGAGGAACCATATAACAGACCAGTTAATGACAGAAAGAGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41407
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101770 Essential Splice Site 48 522 None 13
ENSDART00000126015 Essential Splice Site 48 524 None 13
ENSDART00000139434 Essential Splice Site 47 97 None 6
ENSDART00000145005 Essential Splice Site 47 180 None 7
Genomic Location (Zv9):
Chromosome 9 (position 23667678)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22823464
GRCz11 9 22634333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAGAAAGAGAAAGTTAGTGGAGACTGAACTTGCTCAGGATACAGAGGG[T/A]AAATTCAGCCTAATGAATGTGACTAATGGATGTTTAACAGATGGATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101770 Nonsense 442 522 12 13
ENSDART00000126015 Nonsense 442 524 12 13
ENSDART00000139434 None None 97 None 6
ENSDART00000145005 None None 180 None 7
Genomic Location (Zv9):
Chromosome 9 (position 23680454)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22836240
GRCz11 9 22647109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATGAACTAYGACAAGCTGAGTCGCTCACTGCGCTACTACTATGAGAAG[G/T]GAATCATGCAGAAGGTAAAGRCAGGTTCACCTTTTCCTKTACTTCGCACT
Associated Phenotype:
Not determined