Busch Lab

ZMP

si:dkey-189g17.2

Ensembl ID:
ENSDARG00000069758
ZFIN ID:
ZDB-GENE-030131-5562
Description:
si:dkey-189g17.2 [Source:RefSeq peptide;Acc:NP_001122014]
Human Orthologue:
RBM44
Human Description:
RNA binding motif protein 44 [Source:HGNC Symbol;Acc:24756]
Mouse Orthologue:
Rbm44
Mouse Description:
RNA binding motif protein 44 Gene [Source:MGI Symbol;Acc:MGI:2685663]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21473 Nonsense Available for shipment Available now
sa9695 Nonsense Available for shipment Available now
sa1407 Nonsense Available for shipment Available now
sa21474 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21473
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 282 956 7 18
ENSDART00000136249 None None 167 None 7
ENSDART00000139270 None None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23696458)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22852244
GRCz11 9 22663113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAGTAGAAAGCAGGGAAGATGCCAAACATTTTAAGGACACATCAGCC[C/T]AAGCGAGCTTCTGCCTCGATATGGAGCTTGATGTGCAGAGTCAGGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9695
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 311 956 7 18
ENSDART00000136249 None None 167 None 7
ENSDART00000139270 None None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23696547)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22852333
GRCz11 9 22663202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCAGGTTCAGAGAAATGACAACACCCAAAATAACCAAAAYCAATCATA[T/G]AATCCCACWGAAGAAAATGACYACAATGTGGACCAGGAAACCATGCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1407
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 886 956 18 18
ENSDART00000136249 None None 167 None 7
ENSDART00000139270 None None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23705533)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22861319
GRCz11 9 22672188
KASP Assay ID:
554-1328.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGAAAGGTTGACCAACGTGTGCAACTCGCCCACAGCCTCTGGAACATG[T/A]GTGCCACAGCACTACGCCACCATGGGAAGCTTCGACACAATCATGGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21474
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 889 956 18 18
ENSDART00000136249 None None 167 None 7
ENSDART00000139270 None None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23705540)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22861326
GRCz11 9 22672195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTGACCAACGTGTGCAACTCGCCCACAGCCTCTGGAACATGTGTGCCA[C/T]AGCACTACGCCACCATGGGAAGCTTCGACACAATCATGGCCCGGCTGTCA
Associated Phenotype:
Not determined