Busch Lab

ZMP

capn5b

Ensembl ID:
ENSDARG00000069748
ZFIN ID:
ZDB-GENE-091116-29
Human Orthologue:
CAPN5
Human Description:
calpain 5 [Source:HGNC Symbol;Acc:1482]
Mouse Orthologue:
Capn5
Mouse Description:
calpain 5 Gene [Source:MGI Symbol;Acc:MGI:1100859]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44967 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29580
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101732 Nonsense 243 642 5 12
Genomic Location (Zv9):
Chromosome 21 (position 21150953)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22162446
GRCz11 21 22199082
KASP Assay ID:
2261-5557.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCTTTACATTTGGTATGCAGGCAACCACAGTAGAGGACATGGAAGCA[C/T]GACTGGACTGTGGATTAGTGAAAGGCCATGCTTACGCAGTGACCGACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44967
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101732 Nonsense 433 642 9 12
Genomic Location (Zv9):
Chromosome 21 (position 21162025)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22173518
GRCz11 21 22210154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATTTTTGCCCTATTTTGACCAAGCCTCTTTGGTACCACCAGGTGGAGT[T/A]GAACAGAAAGTACAGAATGCACTCGGCGCAGCAGAAGGTCGCAGGGTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29581
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101732 Essential Splice Site 537 642 10 12
Genomic Location (Zv9):
Chromosome 21 (position 21162415)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22173908
GRCz11 21 22210544
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCATGTGTTAAGTGCCGAGGGCCTGCAGGGCCAAGACGCTAATGGAGG[T/A]ATGAATAGTATTTCTGGTAACAATAAAGGCCCACTAAAGGAATTTTGCAT
Associated Phenotype:
Not determined