Busch Lab

ZMP

foxi2

Ensembl ID:
ENSDARG00000069715
ZFIN ID:
ZDB-GENE-031126-2
Description:
forkhead box I2 [Source:RefSeq peptide;Acc:NP_944598]
Human Orthologue:
FOXI1
Human Description:
forkhead box I1 [Source:HGNC Symbol;Acc:3815]
Mouse Orthologue:
Foxi1
Mouse Description:
forkhead box I1 Gene [Source:MGI Symbol;Acc:MGI:1096329]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31911 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101673 Nonsense 69 383 1 2
Genomic Location (Zv9):
Chromosome 13 (position 13439849)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13447844
GRCz11 13 13578836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCCGGATACGGCCTGGGGGACTACGCGACCCCAAACCCTTACCTGTG[G/A]CTCAATGGACCCGGTGTCAACTCCTCTTCGTCCTACATACACGGAAACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28080
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101673 Nonsense 125 383 1 2
Genomic Location (Zv9):
Chromosome 13 (position 13440016)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13448011
GRCz11 13 13579003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGGGCCGGATTTAGGCTGGCTCTCCATCGCGAGTCAAGAGGAACTTT[T/A]AAAGCTCGTGCGCCCGCCATACTCCTACTCGGCTCTCATAGCCATGGCGA
Associated Phenotype:
Not determined