Busch Lab

ZMP

col7a1l

Ensembl ID:
ENSDARG00000069692
ZFIN ID:
ZDB-GENE-030131-9861
Description:
Novel protein similar to vertebrate collagen family [Source:UniProtKB/TrEMBL;Acc:Q1LYN6]
Human Orthologues:
COL24A1, COL27A1
Human Descriptions:
collagen, type XXIV, alpha 1 [Source:HGNC Symbol;Acc:20821]
collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
Mouse Orthologues:
Col24a1, Col27a1
Mouse Descriptions:
collagen, type XXIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1918605]
collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6935 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6935
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101592 None None 589 None 14
ENSDART00000141566 Essential Splice Site 1067 1722 22 64
Genomic Location (Zv9):
Chromosome 4 (position 14987750)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15923603
GRCz11 4 15922358
KASP Assay ID:
554-4626.1 (used for ordering genotyping assays)
KASP Sequence:
ACCCAGAAGCTCTTGCTAAACCAGAAGGACCTTGTCCGCTTAAYTGCAAG[G/A]TAAATGCTTTCTCTGACAAATGTTATCTCGATGTTACTGTATTTTTTCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3473
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101592 None None 589 None 14
ENSDART00000141566 Essential Splice Site 1156 1722 28 64
Genomic Location (Zv9):
Chromosome 4 (position 14990977)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15926830
GRCz11 4 15925585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGGGGCCTCCTGGTAATACTGGACCTAAAGGACAGAGAGGAGAGAGAG[T/C]AAGTTCAGGCACMGACRACCGTGTTATGTGGTGTATAATTGTGTTTACAT
Associated Phenotype:
Not determined