Busch Lab

ZMP

ENSDARG00000069620

Ensembl ID:
ENSDARG00000069620
Mouse Orthologue:
Gm1123
Mouse Description:
predicted gene 1123 Gene [Source:MGI Symbol;Acc:MGI:2685969]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37849 Nonsense Mutation detected in F1 DNA Not yet available
sa44112 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101460 Nonsense 91 1037 1 24
Genomic Location (Zv9):
Chromosome 24 (position 16354548)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11346773
GRCz11 3 11313316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTCTCCCTCCGTCTGAACAATCTGACAGCTGAAGATAAGGGAGAATA[C/A]ACGTGTACAGTTTACAGTCAGCAAAATGCTGTGTTTTCAACTAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44112
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101460 Nonsense 634 1037 13 24
Genomic Location (Zv9):
Chromosome 24 (position 16333521)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11325746
GRCz11 3 11292289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGCAATTCAGAGGCAGAGTTGAGTTCTTCACTGCTGAAATCCCCAAA[G/T]GAAACTTCTCTCTCAGACTGAAGAGTGTCCGAACTGAGGATAAAGAAGTT
Associated Phenotype:
Not determined