Busch Lab

ZMP

atf7ip

Ensembl ID:
ENSDARG00000069619
ZFIN ID:
ZDB-GENE-061103-178
Description:
Activating transcription factor 7-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A0JME2]
Human Orthologue:
ATF7IP
Human Description:
activating transcription factor 7 interacting protein [Source:HGNC Symbol;Acc:20092]
Mouse Orthologue:
Atf7ip
Mouse Description:
activating transcription factor 7 interacting protein Gene [Source:MGI Symbol;Acc:MGI:1858965]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32740 Nonsense Mutation detected in F1 DNA Not yet available
sa6602 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Nonsense 98 816 3 14
ENSDART00000135089 Nonsense 98 815 3 14
Genomic Location (Zv9):
Chromosome 1 (position 46048382)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44885894
GRCz11 1 45577689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCATCTCCATCCTTCCCAGTCTCTCGATCGCCCTCTCCACCCAACACA[C/T]AGACTACCTCACCTGCGATGGATTTGGAAGACCCCCTTGTGGCCACCGAG
Long Flanking Sequence:
GTGATCAAGGGGAAGAGAGAATTCTAGAACAGCAAGTAATATCTTTTAGATAAGTGACAGTGACACCTTGTGGTCACTCCCCTGTAAAGACATTTCTACTTGGTTAGATTAATCAGACTTGTTGAGTACCACACATAGTTTAGCTAACTAGCCTGGGATCTAGCATTTGTTTTGACATATTCTTCTGTATTTTTTTTTCACAGGTGAAAATGGAAGTAGCTGTACCTGAGGAACCTCAAAAGAAAATCTTTCGCGCACGGAAAACTATGAAGATGAGTGATCGACAGCAATTGGAAGTGCTGCACAACACCCTGGCAACCACCAACTCCAGCTTATCTTCCTCTCCACCTCAGACACCTCTGATGAACGGCACTCATACCGAGACGGAGAAAGACTTGAATAATAAGGAGGGTGACCTGATGGCACCTGCCACAGATTCAGCTCGCTGTTCCCCATCTCCATCCTTCCCAGTCTCTCGATCGCCCTCTCCACCCAACACA[C/T]AGACTACCTCACCTGCGATGGATTTGGAAGACCCCCTTGTGGCCACCGAGGAGAAAAAGGAGACAAGCAATAAAAGTTCATCCTCTTCACCTTCTGCTTCTCCTGCTGGGTTGAACTGTGACCCAGAGGTTAAAGAAGGATTTCTGTGCTTGAGCGAAGAAGATGAGACCCAAGCAGACAAAGATGAAAAAGACAGTAGTGAGGAGAAGATGAATGTAGATGCTGAGACTGAAGACCAAAAAGAGGAAAAGGATGAAAAAGATACTGATACACCTGAGAATGCAGAAGGTGAGGACATCCAACCACCCTGACATTAGAGGTTGACAGGGCTTCTCGATAGAGTTTCATTACAGAGATTGAAAAAATATGAGGTTTTGTTTACAACCTCTACGATGGACTTTCAAACAATTAAAGATCAACAATTCTGTTTCTCCAATTTGACAGAATTATCATTTTTTGTTAGCAAACTGAATATCTAAAGGAATTGTTTACAAAGAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3345
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Essential Splice Site 253 816 4 14
ENSDART00000135089 Essential Splice Site 252 815 4 14
Genomic Location (Zv9):
Chromosome 1 (position 46047366)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44884878
GRCz11 1 45576673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGCTGAAAATCACAGCCAACGGTGGAAACCGGGACAAAATAGAGAAG[G/A]TTTGTTATTATTTAKTGTTTAAGGGAAAGTTCACAAATTTTNCTGTAATAA
Long Flanking Sequence:
CGGATATTTGACAAGCTTGTTCGAGATTTTTTTGATAAATGTCCGAAATGGCTTCTGACCAAACATGGACAAAAATATCGATTTGACAAAATGTAGATGTGAAAATGATAAATATTTTTGGTTGAACTTTCCTTTAAGCTTACTCTAAGTTTTAAAATAACCCAACTGTTTTCAGTTTCCTATAATTGCTGCTGGCATTTGTTTTAGAGCTTGTATGAAGTTTAACCTTTGAGCTAACATTACACTAGTAACAATAGATAGTTTAACAATATAAGTTGTAGGCATTGCCTTTTAAGGCTAAACTCTACCTCCATTTATCAGCAGACAACAGTGCCCCTGTTGGTCTAAAGAGAACATTGTCCGAGGAGAAAGATGAAGATGATAAAGAAATCGAGGAGGAGAGAGATGGGAAACGAGCAAGGCTGGAGGGTGAGGAGCTGGAGGCTCAGCTGGAGCTGAAAATCACAGCCAACGGTGGAAACCGGGACAAAATAGAGAAG[G/A]TTTGTTATTATTTATTGTTTAAGGGAAAGTTCACAAATTTTCTGTAATAAATTGGCCACAATCATTTTAATCTAAACCTTTACGCTTTTATTTCTTCTGTGGAACACCAACGATGCACTTTATTTTAAAGGCTTTGTGACCAAAATTTTCAGGATTCAGTTATTTACTAGACAACAAAATAAAATCAAGCAGTTTAATCTTAGATTATGAATCTAAAACTGTTTATTCTGTTATTAACATTGATGGATTCACATGAGTAAATCTCTTTGGTTCTCCTGTTTCAATTTGGATTAGTCTGGGCTAACCTATTAATTACGGATGTTAGGTAGAATTTTGGAAATTGTTTTGAGAAAAGAGTGCTGAAAGAAATTGATATGGAATTAAATTATAGACTGTCAGAAATAACATGCGTATTCATTTTCTGTCTCCTTCCCCATTAGATGGTGCAGCAGTTAGTCGAGGAACGGTTACGGGTCCTGCAGTTGACTGTATTTGACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Nonsense 593 816 10 14
ENSDART00000135089 Nonsense 592 815 10 14
Genomic Location (Zv9):
Chromosome 1 (position 46044439)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44881951
GRCz11 1 45573746
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCATAATGTAATCNTTGTTTTATTTTTTNCTGTTGCAGMWAATCAGGCCT[C/A]GACACCAAAAACASCCTCTCAGGTAAGTCTCATTTTAAACCACGCTGGTG
Long Flanking Sequence:
CAGGATCAGCAGCAGCTGCGGCTGGTTCACCATCGGCTTCGGCATTGGCTTCTAAGACCGGTATGAGAAAATGTTTTGTGTAAAGTGTGTGTGTGTGTGTGTGTGTGTTTGTTATTTTGCTGGGGTTTTTTTTGGCCTAGGAAGGATTACAGATTTCAAAGATAAAATTTAAATCATGGAATTAATTAAATATTTTTCAAAAAACTGTTAGGTTTTCATTAATTATTATTGCAATTATTACAATTATTGCTGCTGCCTCTTTCAGTTGTTCTTCTTGTAATCACCGTTTCGTTGCATAATCCGGACACATTTGGATACATTGCCCCATTTTATTTATTTAAGTGCTTTGTAAGCTTATTTGACTTGTGTTTTAGTATACATTTTCTAGCACATTTGACTACTTTTATTATAAAGTAAGGTATAGTTTTATTTATTCTTCAGTATTTTTATTCCATAATGTAATCTTGTTTTATTTTTTTCTGTTGCAGATAATCAGGCCT[C/A]GACACCAAAAACAGCCTCTCAGGTAAGTCTCATTTTAAACCACGCTGGTGTGGAAAAAGTATTTGCCTCCTCACTGATTTTTATTTAGTTTTTCCTGAATATTAATTATCCTAATTTCAAAACTGAATGGATTACTTGTTATCTTTGACTAATATTTACATTTTGTTTGATTATCTAAAACCTAAAAGTGTGACAAACCTGCAAAAAATAAGAAATCAGTAAGGAGGCAAACTCTTTCACACCACTGTATGTGGTGATTTAAACTATATAATTGCAGGTTGCTCTATTGTAATGACTAAATTCTTCTTCTTCTCTACAGCCTGGGCGTCCTAAAGGTTCTGTGATTGATCTGACCGAAGATGATGATGATGTTCAAGGTAAAACCACTGTTGTTGATTTCTCTGTAGGTGTTCTCACATTTGCTGAAATTTAATGTCAATTAGCTAGCATTATATGAAGAACCATAATTTGCACTCAATTGAGAAACTGAGCAGCTTTGA
Associated Phenotype:
Not determined