Busch Lab

ZMP

chrm5b

Ensembl ID:
ENSDARG00000069598
ZFIN ID:
ZDB-GENE-041001-169
Description:
cholinergic receptor, muscarinic 5b [Source:RefSeq peptide;Acc:NP_001025331]
Human Orthologue:
CHRM5
Human Description:
cholinergic receptor, muscarinic 5 [Source:HGNC Symbol;Acc:1954]
Mouse Orthologue:
Chrm5
Mouse Description:
cholinergic receptor, muscarinic 5 Gene [Source:MGI Symbol;Acc:MGI:109248]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37058 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37058
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101418 Nonsense 45 457 1 1
Genomic Location (Zv9):
Chromosome 20 (position 29255484)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29326697
GRCz11 20 29229576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTGTTCTCTATGAACCTCTACACGTGCTACATTCTCATGGGATACTG[G/A]TCTTTAGGGAATACAGCATGTGATCTGTGGTTGGCACTTGATTACGTTGC
Associated Phenotype:
Not determined