Busch Lab

ZMP

si:ch211-11o22.2

Ensembl ID:
ENSDARG00000069560
ZFIN ID:
ZDB-GENE-070912-23
Description:
Novel protein similar to vertebrate potassium voltage-gated channel, subfamily H (Eag-related) famil
Human Orthologue:
KCNH3
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 3 [Source:HGNC Symbol;Acc:6252]
Mouse Orthologue:
Kcnh3
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41434 Nonsense Mutation detected in F1 DNA Not yet available
sa21499 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090625 Nonsense 521 874 12 18
ENSDART00000146284 Nonsense 577 914 9 15
Genomic Location (Zv9):
Chromosome 9 (position 28976514)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28132210
GRCz11 9 27942956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTTCATCCGTGTGCATCGACTGCCCAAAGCCCTTGCGCAGCGCATGT[T/A]GGAGTGCTTTCAGACCACATGGTCCGTCAACAATGGCATTGATGTCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21499
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090625 Essential Splice Site 621 874 13 18
ENSDART00000146284 Essential Splice Site 677 914 10 15
Genomic Location (Zv9):
Chromosome 9 (position 28974093)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28129789
GRCz11 9 27940535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGGGCTCCATGGAAGTGCTCAAGGACAACACTGTGCTGGCTATACTGG[G/A]TAAGATCATACTCACCATGCCTAATATCCGATAGCCAGAAAGTGATTCAT
Associated Phenotype:
Not determined