Busch Lab

ZMP

gtf3c4

Ensembl ID:
ENSDARG00000069538
ZFIN ID:
ZDB-GENE-041008-147
Description:
Novel protein similar to human general transcription factor IIIC, polypeptide 4, 90kDa (GTF3C4) [Sou
Human Orthologue:
GTF3C4
Human Description:
general transcription factor IIIC, polypeptide 4, 90kDa [Source:HGNC Symbol;Acc:4667]
Mouse Orthologue:
Gtf3c4
Mouse Description:
general transcription factor IIIC, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:2138937]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa43614 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43614
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101295 Nonsense 78 699 2 5
Genomic Location (Zv9):
Chromosome 21 (position 15932599)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17384378
GRCz11 21 17421014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATCAATCCTCAATGTGGACCTCTCCATGGCGTCAAGTACACTAGTTG[G/A]TCACCGTTAGGCTGTGACAAACTCGGCCGCTGCCTTCTTGCTTTCCTAAC
Associated Phenotype:
Not determined