Busch Lab

ZMP

zgc:153981

Ensembl ID:
ENSDARG00000069529
ZFIN ID:
ZDB-GENE-061103-367
Description:
muscle-restricted dual specificity phosphatase [Source:RefSeq peptide;Acc:NP_001071077]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9957 Essential Splice Site Available for shipment Available now
sa19060 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9957
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
Genomic Location (Zv9):
Chromosome 13 (position 25060619)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24706279
GRCz11 13 24836729
KASP Assay ID:
2260-6418.1 (used for ordering genotyping assays)
KASP Sequence:
AATGGTTGCTGATCTCTATTGGTAATTACAGTCTGTGTCTTTTATGTGTA[G/A]GAAAGGTGCTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTCTG
Long Flanking Sequence:
CGCTGAAGGCATTGTTTGATTGGCTACAATAGTGAGATTACAACAATTACATATATATTTATTTCCCTTATGTTCAGGATTCTCTAAGCTTGTATTATACTTACTATGTACGTGGTACTCTTATTTTGAAAACACAACAAGTTTTAAAGATTGGTTAAGAGGCAGTTTTGTAAAACAGGCAGCCATGTTTGACAACACAACTTAGAAGCATACTATAGTATACATATATGTTACTCGGGTGGCATAAAGATAGCTCAATCCTTCCAGCTAAAATAAAGAGCTCATTAATATGCGCATCCCATACATTCTGTGTAGGCATCAGAGATTAATTAAATATATATCTAAAAGTTTAGATAATAATTGAAAATACTCTTGCCATTAACTCTAGTTTGTTCCATTTTTTAAAAATGTTGGAATATAAAAAGATATTTTGAAGAGTATGGGTAACCAAATGGTTGCTGATCTCTATTGGTAATTACAGTCTGTGTCTTTTATGTGTA[G/A]GAAAGGTGCTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTCTGGTTCTAGCATACCTTATGCTGCGTCAGCGTCTTACCCTGCGCACTGCCATCCAAACAGTCGTACTGCGACGTGCCATCTATCCCAACAGGAACTTTTTGAGCCTTCTCCTGGATTTGGACATTCAGCTACAGAGAAAGCGAATGCTGTGCCCTATTCTCTGACAGAAAAACACAGATGCCATGAGCACACTAATGCCTGTGCATTCATTTTATATAACTAGAGGATGAAGAGTTAGCCATCGTTGGTATGTTTACATTATTTACGATAAGTGTACAGTATATAGCCTATATTGTTTCATAGTAAAACTGGTGCCTTTGGGGTTTAGTGTATGTTGCTGTATAGACCATCTTTGTACTTTTCCATAGATTTACAGGGTTAATTTTAATATTTGCTATAATTTAGCTATAAAACACTTTTTAATATTGAATAAGTGGCTTTGCTTTTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
Genomic Location (Zv9):
Chromosome 13 (position 25060619)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24706279
GRCz11 13 24836729
KASP Assay ID:
2260-6418.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGTTGCTGATCTCTATTGGTAATTACAGTCTGTGTCTTTTATGTGTA[G/A]GAAAGGTGCTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTCTG
Long Flanking Sequence:
CGCTGAAGGCATTGTTTGATTGGCTACAATAGTGAGATTACAACAATTACATATATATTTATTTCCCTTATGTTCAGGATTCTCTAAGCTTGTATTATACTTACTATGTACGTGGTACTCTTATTTTGAAAACACAACAAGTTTTAAAGATTGGTTAAGAGGCAGTTTTGTAAAACAGGCAGCCATGTTTGACAACACAACTTAGAAGCATACTATAGTATACATATATGTTACTCGGGTGGCATAAAGATAGCTCAATCCTTCCAGCTAAAATAAAGAGCTCATTAATATGCGCATCCCATACATTCTGTGTAGGCATCAGAGATTAATTAAATATATATCTAAAAGTTTAGATAATAATTGAAAATACTCTTGCCATTAACTCTAGTTTGTTCCATTTTTTAAAAATGTTGGAATATAAAAAGATATTTTGAAGAGTATGGGTAACCAAATGGTTGCTGATCTCTATTGGTAATTACAGTCTGTGTCTTTTATGTGTA[G/A]GAAAGGTGCTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTCTGGTTCTAGCATACCTTATGCTGCGTCAGCGTCTTACCCTGCGCACTGCCATCCAAACAGTCGTACTGCGACGTGCCATCTATCCCAACAGGAACTTTTTGAGCCTTCTCCTGGATTTGGACATTCAGCTACAGAGAAAGCGAATGCTGTGCCCTATTCTCTGACAGAAAAACACAGATGCCATGAGCACACTAATGCCTGTGCATTCATTTTATATAACTAGAGGATGAAGAGTTAGCCATCGTTGGTATGTTTACATTATTTACGATAAGTGTACAGTATATAGCCTATATTGTTTCATAGTAAAACTGGTGCCTTTGGGGTTTAGTGTATGTTGCTGTATAGACCATCTTTGTACTTTTCCATAGATTTACAGGGTTAATTTTAATATTTGCTATAATTTAGCTATAAAACACTTTTTAATATTGAATAAGTGGCTTTGCTTTTAACTG
Associated Phenotype:
Not determined